View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2086_low_55 (Length: 214)
Name: NF2086_low_55
Description: NF2086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2086_low_55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 33553168 - 33553040
Alignment:
| Q |
1 |
aaaaaattgtttcggctacatctatctttagaagactttgaagttcgaaggtccgcagagaagcatgatagcaatgttcaatattcaaggatgttctaag |
100 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33553168 |
aaaaaattgtttcggctgcatctatccttagaagactt-------cgaaggtccacagagaagcatgatagcaatgttcaatattcaaggatgttctaag |
33553076 |
T |
 |
| Q |
101 |
attgaccataaatccgtacattggtttcttctctta |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33553075 |
attgaccataaatccgtacattggtttcttctctta |
33553040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 144 - 199
Target Start/End: Complemental strand, 33552704 - 33552650
Alignment:
| Q |
144 |
ataaagtgtgacattactctgctcaattagatcctttgtgttttagatcaatactg |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||| |||||||||||||||||| |
|
|
| T |
33552704 |
ataaagtgtgacattactctcctcaattagat-ctttatgttttagatcaatactg |
33552650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University