View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2086_low_56 (Length: 209)
Name: NF2086_low_56
Description: NF2086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2086_low_56 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 20 - 191
Target Start/End: Complemental strand, 2078938 - 2078767
Alignment:
| Q |
20 |
atctaactaacttacaaaatgatatctacacagaatcaaactaaaaaccctaaacagagataaaagtaggaaaataaggatgaatgagctgaaatcataa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2078938 |
atctaactaacttacaaaatgatatctacacagaatcaaactaaaaaccctaaacagagataaaagtaggaaaataaggatgaatgagctgaaatcataa |
2078839 |
T |
 |
| Q |
120 |
accaacaaaaatggaaaataaaccctaaatactctgataccttaattataatgaggaatgagttgaaattat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2078838 |
accaacaaaaatggaaaataaaccctaaataccctgataccttaattataatgaggaatgagttgaaattat |
2078767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University