View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20870_high_7 (Length: 237)
Name: NF20870_high_7
Description: NF20870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20870_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 43210410 - 43210627
Alignment:
| Q |
1 |
tagttggggttaaaaatacgatttgttggagaaatannnnnnngtattgtccgaggtaatgaggagagtggagggagatggttagttgttaacgttacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
43210410 |
tagttggggttaaaaatacgatttgttggagaaatatttttttgtattgtccgaggtaatgaggagagtggagggagatggtttgttggtaacgttacta |
43210509 |
T |
 |
| Q |
101 |
aaacggtagagagtagtagtaccacattattttggcatgaaccatggttgggtgatgaggttttaaaggagtgctttaatgtgctttgagaaaagaagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43210510 |
aaacggtagagagtagtagtaccacattattttggcatgaaccatggttgggtgatgaggttttaaaggagtgctttaatgtgctttgagaa---aagaa |
43210606 |
T |
 |
| Q |
201 |
gaagaggatgacgattatagg |
221 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
43210607 |
gaagaggacgacgattatagg |
43210627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 59 - 103
Target Start/End: Original strand, 21462425 - 21462469
Alignment:
| Q |
59 |
atgaggagagtggagggagatggttagttgttaacgttactaaaa |
103 |
Q |
| |
|
||||||||||||||||||||||||| || | ||| |||||||||| |
|
|
| T |
21462425 |
atgaggagagtggagggagatggtttgtggataatgttactaaaa |
21462469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University