View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20871_low_1 (Length: 293)
Name: NF20871_low_1
Description: NF20871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20871_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 37 - 278
Target Start/End: Complemental strand, 8181124 - 8180883
Alignment:
| Q |
37 |
ttggtggataaatttaaggtgttattagttaatttaggaccggattctatacaattcgtgaagaaattagtaattcaagaatttactttgaatggggata |
136 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
8181124 |
ttggtggataaatttaaggtcttattagttaatttaggaccggattctatataattcgtgaagatattagtaattcacgaatttactttgaatggggata |
8181025 |
T |
|
| Q |
137 |
gagcaattagttctacgtttagtattgaaagaattactatggtcttattagttaatttaggaccagattctatattttttggctgatttcttgatctgca |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8181024 |
gagcaattagttctacgtttagtattgaaagaattactatggtcttattagttaatttaggaccggattctatattttctggctgatttcttgatctgca |
8180925 |
T |
|
| Q |
237 |
gaccatgcttcggatcctgttggatgcatcacatatgattgg |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8180924 |
gaccatgcttcggatcctgttggatgcatcacatgtgattgg |
8180883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 8181148 - 8181116
Alignment:
| Q |
1 |
tttatattttgttatctttttatgttggtggat |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8181148 |
tttatattttgttatctttttatgttggtggat |
8181116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 182 - 278
Target Start/End: Original strand, 26843314 - 26843410
Alignment:
| Q |
182 |
tattagttaatttaggaccagattctatattttttggctgatttcttgatctgcagaccatgcttcggatcctgttggatgcatcacatatgattgg |
278 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||||||||| |||| |||||||||| | |||||||||| |
|
|
| T |
26843314 |
tattagttaatttaggaccggattctatattttttggctgatttcttgatccgcaaaccatgcttcggctcctcttggatgcattagatatgattgg |
26843410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 59 - 87
Target Start/End: Original strand, 26843314 - 26843342
Alignment:
| Q |
59 |
tattagttaatttaggaccggattctata |
87 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26843314 |
tattagttaatttaggaccggattctata |
26843342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 276
Target Start/End: Original strand, 32285825 - 32285899
Alignment:
| Q |
202 |
gattctatattttttggctgatttcttgatctgcagaccatgcttcggatcctgttggatgcatcacatatgatt |
276 |
Q |
| |
|
||||||||| ||||||| ||| ||||||||||| |||| ||||||||| |||||||||||||||| ||| ||||| |
|
|
| T |
32285825 |
gattctatactttttggttgagttcttgatctgtagacaatgcttcggttcctgttggatgcatctcatttgatt |
32285899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University