View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20872_high_12 (Length: 264)
Name: NF20872_high_12
Description: NF20872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20872_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 6 - 248
Target Start/End: Original strand, 5849874 - 5850117
Alignment:
| Q |
6 |
gtgagatgaaattacaatgacccttttggattatgataagatgatacctacaacttgagtatatatgagggaaaaaatgtgtggttcaagagaa-gagaa |
104 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
5849874 |
gtgacatgaaattacaatgacccttttggattatgataagatgatacctacaacttgagtatataagagggaaaaaatgtgtggttcaagagaacgagaa |
5849973 |
T |
 |
| Q |
105 |
aatgttgagaaacgtggaaggtttatagagagtatgttatgggacattcttaatttgtttgcagctagattttgatttacatatttattagtctaataaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5849974 |
aatgttgagaaacgtggaaggtttatagagagtatgttatgggacattcttaatttgtttgcagctagattttgatttacatatttattagtctaataaa |
5850073 |
T |
 |
| Q |
205 |
atgagagccatgtataccaaaaccaatcatatcttattactatt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5850074 |
atgagagccatgtataccaaaaccaatcatatcttattactatt |
5850117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University