View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20872_high_7 (Length: 435)
Name: NF20872_high_7
Description: NF20872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20872_high_7 |
 |  |
|
| [»] scaffold0014 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0014 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 237 - 430
Target Start/End: Original strand, 68706 - 68900
Alignment:
| Q |
237 |
gatgatagatggtttgaaggtggaactgagttacactttttcttttacgaagtctaaactatatgtcctt-tcattactcatatttttctatttaatgaa |
335 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
68706 |
gatgatagatggtttgaaagtggaactgagttacactttttcttttacgaagtctaaactatatgtccttgtcattactcatatttttctatttaatgaa |
68805 |
T |
 |
| Q |
336 |
gtcataaactatgtccttttaatttgtagaagtttgatttgcctatttaatgtatatcatttttaaaattgtcctattaattcgctgaactacct |
430 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
68806 |
gtcataaactatgtccttttaatttgtcgaagtttgatttgcctatttaatgtatatcatttttaaaattgtcctattaattcgctgaactacct |
68900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 43 - 197
Target Start/End: Original strand, 68511 - 68664
Alignment:
| Q |
43 |
ctaggttgtattcatttttgatgagttacttcatgtagcttatgatttattannnnnnngtcattttatatttatgagttaattcaaccactagttttta |
142 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
68511 |
ctagtttgtattcatttttgatgagttacttcatgaagcttatgatttattatttttttgtcatttcatatttatgagttaattcaaccactagtttt-a |
68609 |
T |
 |
| Q |
143 |
tcaatgatagagagaaaaataaaatatgatccttggattggatatcgaattttct |
197 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
68610 |
tcaatgatggagagaaaaataaaatatgatccttggattggatatcgagttttct |
68664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 61; Significance: 5e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 279 - 398
Target Start/End: Original strand, 41363488 - 41363611
Alignment:
| Q |
279 |
ttttacgaagtc-taaactatatgtcctt-tcattactcatatttttctatttaatgaagtcataaactat--gtccttttaatttgtagaagtttgatt |
374 |
Q |
| |
|
||||| |||||| |||||||||||||| | || ||| ||| |||||||||||| ||||||||||||| ||| |||||||||||||||||||||||| || |
|
|
| T |
41363488 |
ttttaagaagtcgtaaactatatgtccatgtctttagtcagatttttctattttatgaagtcataaattatatgtccttttaatttgtagaagtttgctt |
41363587 |
T |
 |
| Q |
375 |
tgcctatttaatgtatatcatttt |
398 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
41363588 |
tgcctatttaatgtatatcctttt |
41363611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University