View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20872_low_9 (Length: 301)
Name: NF20872_low_9
Description: NF20872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20872_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 101 - 283
Target Start/End: Original strand, 41270792 - 41270967
Alignment:
| Q |
101 |
gtgacatttatttggtgtaaaccaaaggggnnnnnnntaaaagagggacagagaaaggaataatgtttgtcaatgtccaagaaaagcaaagtggacaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41270792 |
gtgacatttatttggtgtaaaccaaaggggaaaaaaataaaagagggacagagaaaggaataatgtttgtcaatgtccaagaaaagcaaagtggacaatt |
41270891 |
T |
|
| Q |
201 |
atgtattggtttagtaaatgtggcactgctgagtgcaaaatactataagcatacttctcattttatgacgttattgtcatttc |
283 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41270892 |
atgtattggtt-------tgtggcactgttgagtgcaaaatactataagcatacttctcattttataacgttattgtcatttc |
41270967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 12 - 82
Target Start/End: Original strand, 41270695 - 41270766
Alignment:
| Q |
12 |
atgaaatgggaccc-tatcacttgagtgtccaaggctctaaagacacgagaaagtttggaagattgtgtgag |
82 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41270695 |
atgaaatgggacccctatcacttgagtgtccaaggctctaaagacacgagaaaatttggaagattgtgtgag |
41270766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University