View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20873_high_41 (Length: 291)
Name: NF20873_high_41
Description: NF20873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20873_high_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 7 - 171
Target Start/End: Complemental strand, 43308535 - 43308367
Alignment:
| Q |
7 |
tgagacacttaactgattctccatggagtaaaatgctacgtgcaatgttttaaaaatcaattcgaatatgtcagttcaactagatgcactagagaccaaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
43308535 |
tgagacacttaactgattctccatggagtaaaatgctacatgcaatgttttaaaaatcaattcgaatatgtcagttgaactagatgcattagagaccaaa |
43308436 |
T |
 |
| Q |
107 |
tagttagatggtttgtttgatttaagttatttaaccaaact----gaaccatagttggttcgttcaacc |
171 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
43308435 |
tagttagatggttcgtttgatttaagttatttaaccaaattgaacgaaccatagttggttcgttcaacc |
43308367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University