View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20873_high_47 (Length: 263)
Name: NF20873_high_47
Description: NF20873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20873_high_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 11 - 247
Target Start/End: Complemental strand, 44752909 - 44752673
Alignment:
| Q |
11 |
atgaatctaaaggagaagaaagtgaaggatttaatggtgaataagaagagactagtggaagtaccatacacagcttcacttggacaaacaatgaacacac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44752909 |
atgaatctaaaggagaagaaagtgaaggatttaatggtgaataagaagagactagtggaagtaccatacacagcttcacttggacaaacaatgaacacac |
44752810 |
T |
 |
| Q |
111 |
ttgtagcaaacaaggtagtggcggttccagtggctgcaccgccaggtcagtggattggagcaggagggtctatgattgtggagtctgataaacaaacagg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44752809 |
ttgtagcaaacaaggtagtggcggttccggtggctgcaccgccaggtcagtggattggagcaggagggtctatgattgtggagtctgataaacaaacagg |
44752710 |
T |
 |
| Q |
211 |
agctgtaaggaagcattacatagggatggttactatg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44752709 |
agctgtaaggaagcattacatagggatggttactatg |
44752673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University