View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20873_high_56 (Length: 240)
Name: NF20873_high_56
Description: NF20873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20873_high_56 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 35045916 - 35046056
Alignment:
| Q |
1 |
taacaaattgagaactagttttatttaagtaaaaaattatattatggtgctcccttaaataagtgggtttaattaagtataatatttacatcggtagtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35045916 |
taacaaattgagaactagttttatttaagtaacaaattatattatggtgctccctgaaataagtgggtttaattaagtataatatttacatcggtagtga |
35046015 |
T |
 |
| Q |
101 |
gatcaaccattggaatgtttatgggttaatggtggctagtc |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35046016 |
gatcaaccattggaatgtttatgggttaatggtggctagtc |
35046056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 165 - 239
Target Start/End: Original strand, 35046078 - 35046164
Alignment:
| Q |
165 |
cgatcctacatgtactttgaataggttgtgaatatat------------aaaaaggtttgtaaaccaaaacaactcatttatatatt |
239 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35046078 |
cgatcctacatgtactttgaatagattgtgaatatattgttaaccgtataaaaaggtttgtaaaccaaaacaactcatttatatatt |
35046164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University