View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20873_high_57 (Length: 237)
Name: NF20873_high_57
Description: NF20873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20873_high_57 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 7 - 221
Target Start/End: Complemental strand, 50187809 - 50187595
Alignment:
| Q |
7 |
atgtcgaagaaaatgctttaaatcacaaacaaatgactctatgaactcatctacctgttgaaggccgagaggacccaaaggagtttgtcctgtttcaaca |
106 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50187809 |
atgtccaaaaaaatgctttaaatcacaaacaaatgactctatgaactcatctacctgttgaaggccgagaggacccaaaggagtttgtcctgtttcaaca |
50187710 |
T |
|
| Q |
107 |
tttgcccaaaaatcttggtcatcagaaagccatagtatcactgcttctgcaagtctcatcaataaaatagttgcaaatctttctcttcccacaaatacat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50187709 |
tttgcccaaaaatcttggtcatcagaaagccatagtatcactgcttctgcaagtctcatcaataaaatagttgcaaacctttctcttcccacaaatacat |
50187610 |
T |
|
| Q |
207 |
ctgatgcaatgcctg |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
50187609 |
ctgatgcaatgcctg |
50187595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 111 - 210
Target Start/End: Original strand, 16294108 - 16294207
Alignment:
| Q |
111 |
cccaaaaatcttggtcatcagaaagccatagtatcactgcttctgcaagtctcatcaataaaatagttgcaaatctttctcttcccacaaatacatctga |
210 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||| ||||| ||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
16294108 |
cccaaaaggcttggtcatcagaaagccatagtatgactgtttctgtaagtctcatcaataaaatagttgcaaacctttcccttcccacaaatacatctga |
16294207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University