View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20873_high_61 (Length: 236)

Name: NF20873_high_61
Description: NF20873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20873_high_61
NF20873_high_61
[»] chr1 (1 HSPs)
chr1 (15-202)||(34110822-34111012)


Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 15 - 202
Target Start/End: Original strand, 34110822 - 34111012
Alignment:
15 aaataccatcattgcaatcttttgggaatacgggaatgttatcagcctggtagatgcaaatgctctaataatactaggggtttacttttgtgagatagga 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||    
34110822 aaataccatcattgcaatcttttgggaatacgggaatgttatcagcctggtagatgcaaatgctctaacaatactaggggtttacttttatgagatatga 34110921  T
115 gtaaaagttgtactcttttattaggtgggaagtttaaaaacttt---tattaaggaggttctaccttaatattcaatccggtgtatatgat 202  Q
    |||||||||| |||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||    
34110922 gtaaaagttgcactcttttattaggtgggaagtttaaaaacttttactattaaggaggttctaccttaatattcaatccggtgtatatgat 34111012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University