View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20873_low_41 (Length: 291)

Name: NF20873_low_41
Description: NF20873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20873_low_41
NF20873_low_41
[»] chr4 (1 HSPs)
chr4 (7-171)||(43308367-43308535)


Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 7 - 171
Target Start/End: Complemental strand, 43308535 - 43308367
Alignment:
7 tgagacacttaactgattctccatggagtaaaatgctacgtgcaatgttttaaaaatcaattcgaatatgtcagttcaactagatgcactagagaccaaa 106  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||    
43308535 tgagacacttaactgattctccatggagtaaaatgctacatgcaatgttttaaaaatcaattcgaatatgtcagttgaactagatgcattagagaccaaa 43308436  T
107 tagttagatggtttgtttgatttaagttatttaaccaaact----gaaccatagttggttcgttcaacc 171  Q
    ||||||||||||| ||||||||||||||||||||||||| |    ||||||||||||||||||||||||    
43308435 tagttagatggttcgtttgatttaagttatttaaccaaattgaacgaaccatagttggttcgttcaacc 43308367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University