View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20873_low_42 (Length: 285)
Name: NF20873_low_42
Description: NF20873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20873_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 280
Target Start/End: Complemental strand, 31533639 - 31533379
Alignment:
| Q |
18 |
actatcctctaccaaattttggcattaagcatctgtcacagctgaattatttgcatgattaatgtacaatacttttcatgcttacgattattttaagaac |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31533639 |
actatcctctacgaaattttggcattaagcatctatcacagctgaattatttgcatgattaatgtacaatactttt--tgcttacgattattttaagaac |
31533542 |
T |
 |
| Q |
118 |
tatttggaatttaaataaatcaaacaaacaggtttagacgtaggaaattttatggcattcccaattaccataccatatatactaagaagattcttctttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31533541 |
tatttggaatttaaataaatcaaacaaacaggtttagacgtaggaaattttatggcattcccaattaccataccatatatactaagaagattcttctttg |
31533442 |
T |
 |
| Q |
218 |
atcggttcttgctgattattacaagagcagtcaatggtcggccatgttgatacctttgctact |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31533441 |
atcggttcttgctgattattacaagagcagtcaatggtcggccatgttgatacctttgttact |
31533379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University