View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20873_low_59 (Length: 237)
Name: NF20873_low_59
Description: NF20873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20873_low_59 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 43805470 - 43805689
Alignment:
| Q |
18 |
gttcctccgtcgtaaacaaccaaaatatgaccggagacaaccaccaggtccacggggatatccagtcatcggtaacctccacatgctgggtactctccca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43805470 |
gttcctccgtcgtaaacaaccaaaatatgaccggagacaaccaccaggtccacggggatatccagtcatcggtaacctccacttgctgggtactctccca |
43805569 |
T |
 |
| Q |
118 |
caccgtgcactccaagccttgtccaaaaaacacggtcctatcatgttactacgtttaggacaggtcccaacaatcattgtctcttcctcttcagcagcag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43805570 |
caccgtgcactccaagccttgtccaaaaaacacggtcctatcatgttactacgtttaggacaagtcccaacaatcattgtttcttcctcttcagcagcag |
43805669 |
T |
 |
| Q |
218 |
aacaattcctcaaaacacac |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43805670 |
aacaattcctcaaaacacac |
43805689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University