View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20873_low_61 (Length: 236)
Name: NF20873_low_61
Description: NF20873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20873_low_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 15 - 202
Target Start/End: Original strand, 34110822 - 34111012
Alignment:
| Q |
15 |
aaataccatcattgcaatcttttgggaatacgggaatgttatcagcctggtagatgcaaatgctctaataatactaggggtttacttttgtgagatagga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| || |
|
|
| T |
34110822 |
aaataccatcattgcaatcttttgggaatacgggaatgttatcagcctggtagatgcaaatgctctaacaatactaggggtttacttttatgagatatga |
34110921 |
T |
 |
| Q |
115 |
gtaaaagttgtactcttttattaggtgggaagtttaaaaacttt---tattaaggaggttctaccttaatattcaatccggtgtatatgat |
202 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34110922 |
gtaaaagttgcactcttttattaggtgggaagtttaaaaacttttactattaaggaggttctaccttaatattcaatccggtgtatatgat |
34111012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University