View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20874_high_5 (Length: 237)

Name: NF20874_high_5
Description: NF20874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20874_high_5
NF20874_high_5
[»] chr7 (1 HSPs)
chr7 (1-106)||(2334716-2334821)


Alignment Details
Target: chr7 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 2334716 - 2334821
Alignment:
1 tagtgatgctgtgggctgaatttggattatttggaacaggattcctccttcccctttcaacgcaattgattttggaaataaatagactaaattgatatat 100  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2334716 tagtgatgctgtgggctgaatttggcttatttggaacaggattcctccttcccctttcaacgcaattgattttggaaataaatagactaaattgatatat 2334815  T
101 agactc 106  Q
    ||||||    
2334816 agactc 2334821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University