View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20876_low_11 (Length: 214)
Name: NF20876_low_11
Description: NF20876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20876_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 7e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 20 - 198
Target Start/End: Original strand, 4645672 - 4645850
Alignment:
| Q |
20 |
atgacgcaatttattataattaacnnnnnnngagaaaatacaagatagctagcttggaatgaatttcatcatatcataggaattatattgcatatagaat |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4645672 |
atgacgcaatttattataattaactttatttgagaaaatacaagatagctagcttggaatgaatttcatcatatcataggaattatattgcatatagaat |
4645771 |
T |
|
| Q |
120 |
aaaagatcattaattaagcatagaaagtggttaattaggcaatgtagtagaggggatcagggagcttgaaagtcctttc |
198 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4645772 |
aaaagatcattaattaagcacagaaagtggttaattaggcaatgtagtagaggggatcagggagcttgaaagtcctttc |
4645850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 198
Target Start/End: Original strand, 4650104 - 4650144
Alignment:
| Q |
158 |
gcaatgtagtagaggggatcagggagcttgaaagtcctttc |
198 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
4650104 |
gcaatgtagtaaagaggatcagggagcttgaaagtcctttc |
4650144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University