View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20876_low_7 (Length: 254)
Name: NF20876_low_7
Description: NF20876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20876_low_7 |
 |  |
|
| [»] scaffold0057 (2 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 13)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 24751299 - 24751051
Alignment:
| Q |
1 |
ttaaagtttttgtatatagcaatttgataaaagtatgtctatcaatcacctatagaacggataaaatcaataaactattttacattttgctgagactaaa |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24751299 |
ttaaagtttttgtatatagaaatttgataaaagtatgtctatcaatcacctatagaacggataaaatcaataaactattttacattttgctgagactaaa |
24751200 |
T |
 |
| Q |
101 |
tacaaatttaattctttttattacttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgc-- |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |||| ||||||||||| |
|
|
| T |
24751199 |
tacaaatttaattctttttattacttgtgtaaaaaatagggtaagactgcgtacaatacactaaaatggtgagaccccttcacgaaccgtgcgtatgcgt |
24751100 |
T |
 |
| Q |
199 |
---aggagctttagtgaaccgggttgccattttttactatattcttgga |
244 |
Q |
| |
|
|| |||||||||| ||||||||||||||||||||||| || ||||| |
|
|
| T |
24751099 |
atgagcagctttagtgcaccgggttgccattttttactatttttttgga |
24751051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 124 - 229
Target Start/End: Complemental strand, 29355959 - 29355853
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||| || ||||||| ||| ||||||| | | ||||||||| |||||||||||| |||||||||| |
|
|
| T |
29355959 |
cttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgc |
29355860 |
T |
 |
| Q |
223 |
cattttt |
229 |
Q |
| |
|
| ||||| |
|
|
| T |
29355859 |
ccttttt |
29355853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 124 - 228
Target Start/End: Complemental strand, 12222019 - 12221913
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagc-tttagtgaaccgggttg |
221 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| || ||||||| ||| ||||||| | | ||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
12222019 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttg |
12221920 |
T |
 |
| Q |
222 |
ccatttt |
228 |
Q |
| |
|
|| |||| |
|
|
| T |
12221919 |
ccctttt |
12221913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 138 - 223
Target Start/End: Original strand, 17432393 - 17432479
Alignment:
| Q |
138 |
agggtaagactgcgtacaatacactaaaa-tggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||| ||| |||||||||||||||| ||||||||| | |||||| ||| || | |||| |||||||||||| ||||||||||| |
|
|
| T |
17432393 |
agggtaaggctgtgtacaatacactaaaaatggtgagaccttttcccggatcctgtgcatgcgggagctttagtgcaccgggttgcc |
17432479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 133 - 230
Target Start/End: Original strand, 1347004 - 1347100
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| |||||| |
|
|
| T |
1347004 |
aaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
1347100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 126 - 211
Target Start/End: Complemental strand, 7947472 - 7947387
Alignment:
| Q |
126 |
tgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtg |
211 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||| ||||||||| | | ||||||| | | |||||||| |||||||||||| |
|
|
| T |
7947472 |
tgtgtaaaaaccagggtaaggctgcgtacaatacaccaaaatggtgggcccccttcccggaccttgcgtatgtgggagctttagtg |
7947387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 124 - 165
Target Start/End: Original strand, 20400700 - 20400741
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaa |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
20400700 |
cttgtgtaaaaaacagggtaagactgcgtacagtacactaaa |
20400741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 133 - 228
Target Start/End: Complemental strand, 1354850 - 1354756
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttt |
228 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| |||| |
|
|
| T |
1354850 |
aaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
1354756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 124 - 161
Target Start/End: Original strand, 1941888 - 1941925
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1941888 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacac |
1941925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 124 - 161
Target Start/End: Original strand, 6024266 - 6024303
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6024266 |
cttgtgtaaaaaacatggtaagactgcgtacaatacac |
6024303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 125 - 220
Target Start/End: Complemental strand, 3815178 - 3815084
Alignment:
| Q |
125 |
ttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggtt |
220 |
Q |
| |
|
|||||||||||| | |||| ||||||||||||||||| |||||||| ||| |||||||| | | ||||||| | |||||||||| |||||||| |
|
|
| T |
3815178 |
ttgtgtaaaaaatatggtacgactgcgtacaatacac-caaatggtgggaccctttcccgaaccctacgtatgcggaagctttagtgcaccgggtt |
3815084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 124 - 159
Target Start/End: Original strand, 8409276 - 8409311
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatac |
159 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8409276 |
cttgtgtaaaaaacagggtaaggctgcgtacaatac |
8409311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 230
Target Start/End: Complemental strand, 30786413 - 30786371
Alignment:
| Q |
188 |
cgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
30786413 |
cgtgcgtatgcgggagctttagtgcaccgggttgccttttttt |
30786371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 42)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 124 - 230
Target Start/End: Complemental strand, 20639761 - 20639655
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||| ||| ||||||| | | ||||||||| |||||||||||| ||||||||||| |
|
|
| T |
20639761 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
20639662 |
T |
 |
| Q |
224 |
atttttt |
230 |
Q |
| |
|
|||||| |
|
|
| T |
20639661 |
ctttttt |
20639655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 124 - 230
Target Start/End: Complemental strand, 16408705 - 16408598
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||||| || ||||||| | | || ||||| |||||||||||| |||||||||| |
|
|
| T |
16408705 |
cttgtgtaaaaaacagggtaagactgcgtacaatacaccaataatggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgc |
16408606 |
T |
 |
| Q |
223 |
catttttt |
230 |
Q |
| |
|
| |||||| |
|
|
| T |
16408605 |
cctttttt |
16408598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 124 - 230
Target Start/End: Original strand, 23501820 - 23501927
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| || ||||||| ||| ||||||| | | ||| ||||| |||||||||||| |||||||||| |
|
|
| T |
23501820 |
cttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgc |
23501919 |
T |
 |
| Q |
223 |
catttttt |
230 |
Q |
| |
|
| |||||| |
|
|
| T |
23501920 |
cctttttt |
23501927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 124 - 222
Target Start/End: Original strand, 21489120 - 21489218
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||| ||| ||||||||| ||| ||||||||| | ||||||||| |||||||| ||| || ||||||| |
|
|
| T |
21489120 |
cttgcgtaaaaaacagagtaagactgcgtacaatgcaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttcgtgcactgggttgc |
21489218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 231
Target Start/End: Original strand, 35567202 - 35567309
Alignment:
| Q |
123 |
acttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||| |||| ||| ||||| ||| ||||||||| | ||||| ||| |||||||||||| |||||| ||| |
|
|
| T |
35567202 |
acttgtgtaaaaaacagggtaaggctgtgtacaacacaccaaa-tggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgcaccgggctgc |
35567300 |
T |
 |
| Q |
223 |
catttttta |
231 |
Q |
| |
|
| ||||||| |
|
|
| T |
35567301 |
cctttttta |
35567309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 124 - 229
Target Start/End: Complemental strand, 13256503 - 13256397
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| || ||| ||| ||| ||||||||| | || | ||| |||||||||||| |||||||||| |
|
|
| T |
13256503 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggttgc |
13256404 |
T |
 |
| Q |
223 |
cattttt |
229 |
Q |
| |
|
| ||||| |
|
|
| T |
13256403 |
ccttttt |
13256397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 132 - 230
Target Start/End: Original strand, 30639420 - 30639517
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||||||||| ||||||| | | ||| ||||| |||||||||||| || |||||||| |||||| |
|
|
| T |
30639420 |
aaaaacagggtaaggctgcgtacaatacaccaaa-tggtgagaccccttcccggaccctgcatatgcgggagctttagtgcactgggttgccctttttt |
30639517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 124 - 230
Target Start/End: Original strand, 47443990 - 47444095
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||| ||||||||||||| |||| || |||||||| |
|
|
| T |
47443990 |
cttgcgtaaaaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgcaggagcttcagtgcactgggttgcc |
47444088 |
T |
 |
| Q |
224 |
atttttt |
230 |
Q |
| |
|
|||||| |
|
|
| T |
47444089 |
ctttttt |
47444095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 130 - 211
Target Start/End: Complemental strand, 20908733 - 20908652
Alignment:
| Q |
130 |
taaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtg |
211 |
Q |
| |
|
||||||| | |||||| ||||||||||||||| ||||||||| ||| ||||||||| | ||||||||| |||||||||||| |
|
|
| T |
20908733 |
taaaaaagaaggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtg |
20908652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 132 - 223
Target Start/End: Complemental strand, 6430720 - 6430630
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||||||||| |||||||||| | ||||||||||| |
|
|
| T |
6430720 |
aaaaacagggtaaggctgcgtacaatacac-caaatggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcaccgggttgcc |
6430630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 124 - 186
Target Start/End: Complemental strand, 48327867 - 48327804
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaa |
186 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| || ||||||| ||| |||||||||| |
|
|
| T |
48327867 |
cttgtgtaaaaaacagggtaagactgcatacaatacaccaataatggtgggacctcttcccgaa |
48327804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 132 - 230
Target Start/End: Complemental strand, 36816479 - 36816381
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
|||||||||| | | ||||||||||||||| |||| |||| |||| ||||| | | | || |||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
36816479 |
aaaaacagggcagggctgcgtacaatacaccaaaaaggtgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgccctttttt |
36816381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 126 - 223
Target Start/End: Complemental strand, 44363232 - 44363134
Alignment:
| Q |
126 |
tgtgtaaaaaacagggtaagactgcgtacaatacactaaaa-tggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||||||| | |||||||||| ||| |||| ||||| ||| ||||||| | | ||||||||| |||||||||||| ||||||||||| |
|
|
| T |
44363232 |
tgtgtaaaaaacagggtagggctgcgtacaacgcaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
44363134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 132 - 229
Target Start/End: Original strand, 54175104 - 54175202
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttctt-cccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattttt |
229 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||| ||| ||| |||| | | ||| ||||| |||||||||||| |||||| |||| ||||| |
|
|
| T |
54175104 |
aaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttccccggaccctgcatatgcgggagctttagtgcaccgggctgcccttttt |
54175202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 132 - 229
Target Start/End: Original strand, 5648299 - 5648395
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattttt |
229 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||||||||| ||||||| |||| || |||||||| ||||| |
|
|
| T |
5648299 |
aaaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgcccttttt |
5648395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 124 - 228
Target Start/End: Original strand, 16911595 - 16911700
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||| ||| ||||||||| ||||||||||||||| || ||||||| ||| ||||||| | | |||||| || ||||||||||| |||||||||| |
|
|
| T |
16911595 |
cttgtgtacaaatcagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtacgcgggagctttagtttaccgggttgc |
16911694 |
T |
 |
| Q |
223 |
catttt |
228 |
Q |
| |
|
| |||| |
|
|
| T |
16911695 |
cctttt |
16911700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 124 - 229
Target Start/End: Original strand, 25629082 - 25629186
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||||||| |||||||| ||| ||||||| | | | | ||||| |||||||||||| ||||||||||| |
|
|
| T |
25629082 |
cttgtgtaaaaaatagggtaaggctgtgtacaatacac-caaatggtgggaccccttcccggaccctacatatgcgggagctttagtgcaccgggttgcc |
25629180 |
T |
 |
| Q |
224 |
attttt |
229 |
Q |
| |
|
||||| |
|
|
| T |
25629181 |
cttttt |
25629186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 124 - 209
Target Start/End: Complemental strand, 39029163 - 39029078
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttag |
209 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||| ||||||||| ||| ||| ||| | | ||| ||||| |||||||||| |
|
|
| T |
39029163 |
cttgtgtaaaaaacagggtaaggctgtgtacaatacacgaaaatggtgggaccactttccggaccctgcatatgcgggagctttag |
39029078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 228
Target Start/End: Original strand, 7038085 - 7038188
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| ||||||||| | | || |||| | | ||||||| | |||||||||||| || |||||||| |
|
|
| T |
7038085 |
cttgtgtaaaaaatagggtaagacttcgtacaatacaccaaaatggtggggcacctacccggaccctgcgtatac-ggagctttagtgcactgggttgcc |
7038183 |
T |
 |
| Q |
224 |
atttt |
228 |
Q |
| |
|
|||| |
|
|
| T |
7038184 |
ctttt |
7038188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 133 - 229
Target Start/End: Complemental strand, 9832406 - 9832311
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattttt |
229 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||| ||||||||| || ||||| ||||||||||| ||||| |
|
|
| T |
9832406 |
aaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgcaggaactctagtgcaccgggttgcccttttt |
9832311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 228
Target Start/End: Original strand, 14983867 - 14983970
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||||||| |||||||| ||| ||||||| | | ||||||||| |||||||||||| ||| |||||| |
|
|
| T |
14983867 |
cttgtgtaaaaaatagggtaaggttgcctacaatacact-aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcc |
14983965 |
T |
 |
| Q |
224 |
atttt |
228 |
Q |
| |
|
|||| |
|
|
| T |
14983966 |
ctttt |
14983970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 133 - 229
Target Start/End: Complemental strand, 48598918 - 48598823
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattttt |
229 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| ||||| |
|
|
| T |
48598918 |
aaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccatgcatatgccggagctctagtgcaccgggttgcccttttt |
48598823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 125 - 196
Target Start/End: Complemental strand, 35894563 - 35894492
Alignment:
| Q |
125 |
ttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtat |
196 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||| ||||||||| ||| ||||||| ||| ||||||| |
|
|
| T |
35894563 |
ttgtgtaaaaaacacggtaagtgtgcgtacaatacaccaaaatggtgggaccccttcccggatcatgcgtat |
35894492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 133 - 223
Target Start/End: Original strand, 20225024 - 20225113
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| |
|
|
| T |
20225024 |
aaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
20225113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 124 - 166
Target Start/End: Original strand, 25343220 - 25343262
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaa |
166 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
25343220 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaa |
25343262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 133 - 223
Target Start/End: Complemental strand, 29207991 - 29207902
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| |
|
|
| T |
29207991 |
aaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
29207902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 230
Target Start/End: Complemental strand, 11054241 - 11054145
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| | || ||||||| | | ||| ||||| |||||| ||||| ||||||||||| |||||| |
|
|
| T |
11054241 |
aaaacagggtaagactgcgtacaatacac-caaatggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
11054145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 124 - 161
Target Start/End: Original strand, 19027881 - 19027918
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19027881 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacac |
19027918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 131 - 211
Target Start/End: Original strand, 20405127 - 20405208
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtg |
211 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||| ||| ||||||| | | || ||||| |||||||||||| |
|
|
| T |
20405127 |
aaaaaacagggtaagattgcgtacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtg |
20405208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 131 - 212
Target Start/End: Complemental strand, 30581561 - 30581480
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtga |
212 |
Q |
| |
|
||||||||||||||| || ||||||||||| ||||||||| ||| ||||||| | | ||| |||| |||||||||||||| |
|
|
| T |
30581561 |
aaaaaacagggtaagggtgtgtacaatacaccaaaatggtgggaccccttcccggaccctgcatatgtaggagctttagtga |
30581480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 230
Target Start/End: Complemental strand, 39077889 - 39077793
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
||||||||||||| ||||||||||| || ||| ||||||||| |||| ||| | | ||| ||||| |||||| ||||| ||||||||||| |||||| |
|
|
| T |
39077889 |
aaaacagggtaaggttgcgtacaatataccaaa-tggtgagacatctttccggaccctgcatatgcgggagctctagtgcaccgggttgccttttttt |
39077793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 124 - 217
Target Start/End: Complemental strand, 51865140 - 51865048
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgg |
217 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||| |||||||| | | ||||||| | | ||||||||| ||||||||| || ||||| |
|
|
| T |
51865140 |
cttgtgtaaaaaacatggtaaggctgcgtacaatacac-caaatggtggggccccttcccggaccctgcgtatgcgggagctttattgcaccgg |
51865048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 132 - 223
Target Start/End: Complemental strand, 7909375 - 7909284
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgc-aggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| ||| ||||||||| | ||||||||| |||||||||||| | ||||||||| |
|
|
| T |
7909375 |
aaaaacagggtaaggttgcgtacaatacac-caaatggtgggaccccttcccgaaccctgcgtatgcggggagctttagtgcatcgggttgcc |
7909284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 136 - 223
Target Start/End: Original strand, 20225119 - 20225207
Alignment:
| Q |
136 |
acagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||| ||||||||||||||| || ||||||| ||| ||||||| | | || ||||| |||||||||||| ||||||||||| |
|
|
| T |
20225119 |
acagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcc |
20225207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 124 - 171
Target Start/End: Complemental strand, 487237 - 487190
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtg |
171 |
Q |
| |
|
|||||||| |||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
487237 |
cttgtgtataaaacaaggtaaagctgcgtacaatacactaaaatggtg |
487190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 124 - 175
Target Start/End: Complemental strand, 23580310 - 23580259
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagac |
175 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||| ||||||| ||||| |
|
|
| T |
23580310 |
cttgtgtaaaaaacaggggaagactgcgtaggatacaccaaaatggcgagac |
23580259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 124 - 161
Target Start/End: Complemental strand, 17043496 - 17043459
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
17043496 |
cttgtgtaaaatacagggtaaggctgcgtacaatacac |
17043459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 130 - 211
Target Start/End: Complemental strand, 30690272 - 30690192
Alignment:
| Q |
130 |
taaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtg |
211 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| || ||||| ||| ||||||| | | ||||||||| |||||||||||| |
|
|
| T |
30690272 |
taaaaaacagggtaaggctgcatacaatacac-caattggtgggaccccttcccggaccctgcgtatgcgggagctttagtg |
30690192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 133 - 230
Target Start/End: Complemental strand, 47528623 - 47528527
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | || |||| |||||| ||||| ||||||||||| |||||| |
|
|
| T |
47528623 |
aaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgaatatgtgggagctctagtgcaccgggttgccctttttt |
47528527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 133 - 206
Target Start/End: Original strand, 49796839 - 49796911
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctt |
206 |
Q |
| |
|
|||||| |||||| ||||||||||||||| |||||||| ||| ||||||||| | ||||||||| ||||||| |
|
|
| T |
49796839 |
aaaacatggtaaggctgcgtacaatacac-caaatggtgggaccccttcccgaaccctgcgtatgcgggagctt |
49796911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 230
Target Start/End: Complemental strand, 30352661 - 30352577
Alignment:
| Q |
147 |
ctgcgtacaatacactaaaa-tggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
||||||||||||||| |||| ||||| ||| |||| || | | ||||||||| |||||||||||| |||| |||||| |||||| |
|
|
| T |
30352661 |
ctgcgtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgccctttttt |
30352577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 230
Target Start/End: Original strand, 35532090 - 35532130
Alignment:
| Q |
190 |
tgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
35532090 |
tgcgtatgcgggagctttagtgcaccgggttgccctttttt |
35532130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 42)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 124 - 234
Target Start/End: Complemental strand, 46248055 - 46247946
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||| ||||||| | | ||||||||| |||||||||||| ||||||||||| |
|
|
| T |
46248055 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac-caaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgcc |
46247957 |
T |
 |
| Q |
224 |
attttttacta |
234 |
Q |
| |
|
|||||||||| |
|
|
| T |
46247956 |
cttttttacta |
46247946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 230
Target Start/End: Original strand, 18944699 - 18944807
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagc-tttagtgaaccgggttg |
221 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| || ||||||| ||| ||||||| | | ||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
18944699 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacaccaacaatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttg |
18944798 |
T |
 |
| Q |
222 |
ccatttttt |
230 |
Q |
| |
|
|| |||||| |
|
|
| T |
18944799 |
ccctttttt |
18944807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 129 - 223
Target Start/End: Original strand, 4349699 - 4349792
Alignment:
| Q |
129 |
gtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||||||||| |||||||||||| ||||||||||| |
|
|
| T |
4349699 |
gtaaaaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
4349792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 124 - 228
Target Start/End: Original strand, 35005179 - 35005284
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||| | ||||||||| ||| ||||||| | | ||||||||| || ||||||||| |||||||||| |
|
|
| T |
35005179 |
cttgtgtaaaaaacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggcgctttagtgcaccgggttgc |
35005278 |
T |
 |
| Q |
223 |
catttt |
228 |
Q |
| |
|
| |||| |
|
|
| T |
35005279 |
cctttt |
35005284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 124 - 228
Target Start/End: Original strand, 10668281 - 10668386
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||| || ||||||| ||| ||||||| | ||||||||| |||||||||||| |||||||||| |
|
|
| T |
10668281 |
cttgtgtaaaaaacaaggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggttgc |
10668380 |
T |
 |
| Q |
223 |
catttt |
228 |
Q |
| |
|
| |||| |
|
|
| T |
10668381 |
cctttt |
10668386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 124 - 228
Target Start/End: Complemental strand, 30395830 - 30395725
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| || ||||||| ||| ||||||| | | || ||||| |||||||||||| |||| ||||| |
|
|
| T |
30395830 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgc |
30395731 |
T |
 |
| Q |
223 |
catttt |
228 |
Q |
| |
|
| |||| |
|
|
| T |
30395730 |
cctttt |
30395725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 231
Target Start/End: Original strand, 27201703 - 27201811
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
||||||| | |||||||||||| |||||||||||||| | ||||||||| ||| ||||||| | | ||||||||| |||||||||||| | ||||||| |
|
|
| T |
27201703 |
cttgtgtcagaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccttgcgtatgcgggagctttagtgcattgggttgc |
27201802 |
T |
 |
| Q |
223 |
catttttta |
231 |
Q |
| |
|
| ||||||| |
|
|
| T |
27201803 |
cctttttta |
27201811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 125 - 223
Target Start/End: Complemental strand, 19932856 - 19932757
Alignment:
| Q |
125 |
ttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| | ||||||||| ||| ||||||| | | |||||||||| || | |||||| ||| ||||||| |
|
|
| T |
19932856 |
ttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcaccaggttgcc |
19932757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 124 - 211
Target Start/End: Complemental strand, 23768422 - 23768336
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtg |
211 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||| ||| |||||| | | ||||||||| |||||||||||| |
|
|
| T |
23768422 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacac-caaatggtgggacaccttcccagaccctgcgtatgcgggagctttagtg |
23768336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 133 - 228
Target Start/End: Complemental strand, 34725191 - 34725097
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttt |
228 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| |||| |
|
|
| T |
34725191 |
aaaacagggtaaggctgcgtacaatacact-aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
34725097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 124 - 223
Target Start/End: Original strand, 46991860 - 46991958
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||| ||||||| ||| ||||||| | | |||||||| |||||||||||| ||||||||||| |
|
|
| T |
46991860 |
cttgtgtaaaaaacagggtaaggctgtgtacaatacac-cgaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccgggttgcc |
46991958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 124 - 161
Target Start/End: Complemental strand, 4430128 - 4430091
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4430128 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
4430091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 131 - 176
Target Start/End: Original strand, 46859129 - 46859174
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaatacactaaaatggtgagact |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
46859129 |
aaaaaacagggtaagactgcgtacaatacaccaaaatggtgggact |
46859174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 136 - 207
Target Start/End: Original strand, 15505632 - 15505702
Alignment:
| Q |
136 |
acagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagcttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||| ||||||||| | ||||||||| |||||||| |
|
|
| T |
15505632 |
acagggtaagactgcgtacaatacac-caaatggtgggaccccttcccgaaccctgcgtatgcgggagcttt |
15505702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 124 - 167
Target Start/End: Complemental strand, 17470448 - 17470405
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaat |
167 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
17470448 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaat |
17470405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 131 - 229
Target Start/End: Complemental strand, 18742054 - 18741955
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaataca-ctaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattttt |
229 |
Q |
| |
|
||||||||||||||| |||||||||||||| | ||||||||| ||| |||||| | | ||||||||| ||||||||||| |||||||| || ||||| |
|
|
| T |
18742054 |
aaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtttcccttttt |
18741955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 127 - 228
Target Start/End: Complemental strand, 20004191 - 20004089
Alignment:
| Q |
127 |
gtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccat |
225 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||| || ||||||| ||| |||||| | | || ||||| |||||||||||| ||||||||||| | |
|
|
| T |
20004191 |
gtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
20004092 |
T |
 |
| Q |
226 |
ttt |
228 |
Q |
| |
|
||| |
|
|
| T |
20004091 |
ttt |
20004089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 132 - 229
Target Start/End: Complemental strand, 42304303 - 42304205
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaa-tggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattttt |
229 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||| ||||| ||| ||||||| | | |||||||| |||||||||||| ||||| ||||| ||||| |
|
|
| T |
42304303 |
aaaaacagggtaaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgcccttttt |
42304205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 124 - 161
Target Start/End: Complemental strand, 41319908 - 41319871
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41319908 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacac |
41319871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 190 - 230
Target Start/End: Complemental strand, 1517348 - 1517308
Alignment:
| Q |
190 |
tgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
1517348 |
tgcgtatgcaggagctttagtgcaccgggttgccctttttt |
1517308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 132 - 228
Target Start/End: Original strand, 27474344 - 27474439
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttt |
228 |
Q |
| |
|
|||||||||| || |||||||||||||||| || ||||| ||| ||||||| | | ||||||||| |||||||||||| ||||| ||||| |||| |
|
|
| T |
27474344 |
aaaaacagggcaaagctgcgtacaatacactgaa-tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccctttt |
27474439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 160
Target Start/End: Complemental strand, 34679321 - 34679285
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaataca |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34679321 |
cttgtgtaaaaaacagggtaagactgcgtactataca |
34679285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 218
Target Start/End: Complemental strand, 35117870 - 35117774
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaaatggtgagacttcttcccgaatcgtgcgt-atgcaggagctttagtgaaccggg |
218 |
Q |
| |
|
||||||||||| |||||||||| ||| |||||||||| | |||||| || ||| ||||||| | | ||||| ||||||||||||||||| |||||| |
|
|
| T |
35117870 |
cttgtgtaaaatacagggtaaggctgtgtacaatacaccaaaaatgatgggaccccttcccggaccctgcgtaatgcaggagctttagtgcaccggg |
35117774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 229
Target Start/End: Complemental strand, 35253280 - 35253185
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattttt |
229 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||| ||||| ||||| |
|
|
| T |
35253280 |
aaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgcccttttt |
35253185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 126 - 217
Target Start/End: Complemental strand, 2435887 - 2435796
Alignment:
| Q |
126 |
tgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgg |
217 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||||||| ||||||||| ||| ||| ||| | | | || |||| |||||||||||| ||||| |
|
|
| T |
2435887 |
tgtgtgaaaaatagggtaagcctgcgtacaatacaccaaaatggtgggacccctttccgtaccctccgcatgcgggagctttagtgcaccgg |
2435796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 133 - 228
Target Start/End: Original strand, 19414502 - 19414596
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttt |
228 |
Q |
| |
|
|||||||| |||| ||||||||||||||| |||||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| |||| |
|
|
| T |
19414502 |
aaaacaggttaaggctgcgtacaatacac-caaatggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
19414596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 124 - 211
Target Start/End: Original strand, 19701626 - 19701713
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtg |
211 |
Q |
| |
|
|||||||||||||| |||||| || ||||||||||| ||||||||| | | ||||||| | | ||||||||| |||||||||||| |
|
|
| T |
19701626 |
cttgtgtaaaaaacttggtaaggatgggtacaatacaccaaaatggtggggccccttcccggaccctgcgtatgcgggagctttagtg |
19701713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 124 - 171
Target Start/End: Complemental strand, 27136754 - 27136707
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtg |
171 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||| ||||||||| |
|
|
| T |
27136754 |
cttgtgtaaaaaacatggtaaggttgcgtacaatacaccaaaatggtg |
27136707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 124 - 223
Target Start/End: Complemental strand, 39215061 - 39214962
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| | ||||||||| | | |||||| || | |||||||| | |||||||||| |||||| |||| |
|
|
| T |
39215061 |
cttgtgtaaaaaactgggtaaggctgcgtacaatattccaaaatggtgggtccccttcccaaaccctgcgtatgtggaagctttagtgcaccgggctgcc |
39214962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 228
Target Start/End: Complemental strand, 6983907 - 6983810
Alignment:
| Q |
130 |
taaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttt |
228 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| ||| ||| ||| | | |||||| ||||||||||| ||| |||||| |||| |||| |
|
|
| T |
6983907 |
taaaaaacagggtaagtatgcgtacaatacac-caaatggtgggacccctttccggaccctgcgtaggcaggagctttggtgcaccgggctgccctttt |
6983810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 171
Target Start/End: Complemental strand, 15511253 - 15511204
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcg--tacaatacactaaaatggtg |
171 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
15511253 |
cttgtgtaaaaaacagggtaaggctgcggatacaatacaccaaaatggtg |
15511204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 230
Target Start/End: Original strand, 23796521 - 23796626
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||| || ||||| |||||||||||||| ||| ||||||||| |||||| | | ||| ||||| |||||||||||| |||||| |||| |
|
|
| T |
23796521 |
cttgtgtaaaaatcaatgtaaggttgcgtacaatacaccaaa-tggtgagaccccttcccagaccctgcatatgctggagctttagtgcaccgggctgcc |
23796619 |
T |
 |
| Q |
224 |
atttttt |
230 |
Q |
| |
|
|||||| |
|
|
| T |
23796620 |
ctttttt |
23796626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 230
Target Start/End: Complemental strand, 31382308 - 31382211
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
||||||||| |||| ||||||||||||||| |||||||| ||| ||||| | | | ||| ||||| ||||||||| || ||||||||||| |||||| |
|
|
| T |
31382308 |
aaaaacaggataaggctgcgtacaatacac-caaatggtgggaccccttcctggaccctgcatatgcgggagctttactgtaccgggttgccctttttt |
31382211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 229
Target Start/End: Original strand, 50812003 - 50812100
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattttt |
229 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||| ||| ||||||| | ||||||||| ||||||||| || || ||| |||| ||||| |
|
|
| T |
50812003 |
aaaaaacagggtaaggttgcgtacaatacaccaaaatggtg-gaccccttcccgcgccctgcgtatgcgggagctttaatgcactgggctgcccttttt |
50812100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 132 - 229
Target Start/End: Original strand, 6358185 - 6358282
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattttt |
229 |
Q |
| |
|
|||| |||||||| |||||||||| |||| ||||||||| ||| |||||| | | ||||||||||||| ||||||||| | ||| |||| ||||| |
|
|
| T |
6358185 |
aaaatcagggtaaagctgcgtacaaaacaccaaaatggtgggaccccttcccagaccctgcgtatgcaggatctttagtgatcggggctgcccttttt |
6358282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 124 - 161
Target Start/End: Complemental strand, 18724647 - 18724610
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
18724647 |
cttgtgtaaaaaacagggtaaggctgtgtacaatacac |
18724610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 131 - 184
Target Start/End: Complemental strand, 31442485 - 31442432
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccg |
184 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||| ||| ||||||| |
|
|
| T |
31442485 |
aaaaaacagggtaaggatgcgtacaatacaccaaaatggtgggaccccttcccg |
31442432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 133 - 230
Target Start/End: Complemental strand, 45812630 - 45812534
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
|||| |||||||| |||| |||||||||| ||| ||||| ||| |||||| || | ||| ||||| |||||| ||||| ||||||||||| |||||| |
|
|
| T |
45812630 |
aaaagagggtaaggctgcatacaatacaccaaa-tggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccgggttgccttttttt |
45812534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 220
Target Start/End: Original strand, 14617094 - 14617189
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggtt |
220 |
Q |
| |
|
|||||||||| |||| |||||| |||||||||||||| |||||||| || ||||||| | | ||| ||||| |||||||||||| |||||||| |
|
|
| T |
14617094 |
cttgtgtaaataacaaggtaaggttgcgtacaatacac-caaatggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccgggtt |
14617189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 220
Target Start/End: Complemental strand, 32632651 - 32632564
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggtt |
220 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||| |||||| || | ||| ||||| ||||||| |||| ||| |||| |
|
|
| T |
32632651 |
aaaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgcaccaggtt |
32632564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 207
Target Start/End: Complemental strand, 44485212 - 44485129
Alignment:
| Q |
123 |
acttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagcttt |
207 |
Q |
| |
|
|||||||||||| ||| |||||| ||||||||||||||| ||||||| ||| ||||||| ||| | ||||||| |||||||| |
|
|
| T |
44485212 |
acttgtgtaaaagacatggtaaggctgcgtacaatacac-caaatggttggaccccttcccggatcctacgtatgcgggagcttt |
44485129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 223
Target Start/End: Original strand, 45402175 - 45402250
Alignment:
| Q |
147 |
ctgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||||| ||| ||||| ||| |||||| | | ||||||||| |||||||||||| ||||||||||| |
|
|
| T |
45402175 |
ctgcgtacaatacaccaaa-tggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgcc |
45402250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 42)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 124 - 231
Target Start/End: Complemental strand, 40272914 - 40272808
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||||||||| |||||||||||| ||||||||||| |
|
|
| T |
40272914 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
40272816 |
T |
 |
| Q |
224 |
atttttta |
231 |
Q |
| |
|
||||||| |
|
|
| T |
40272815 |
ctttttta |
40272808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 124 - 228
Target Start/End: Complemental strand, 13628894 - 13628789
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||| || ||||||| ||| ||||||| | | ||||||||| |||||||||||| |||||||||| |
|
|
| T |
13628894 |
cttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgc |
13628795 |
T |
 |
| Q |
223 |
catttt |
228 |
Q |
| |
|
| |||| |
|
|
| T |
13628794 |
cctttt |
13628789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 223
Target Start/End: Complemental strand, 45786318 - 45786218
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| | ||||||||| ||| ||||||| | | |||| |||| |||||||||||| |||||||||| |
|
|
| T |
45786318 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgcaccgggttgc |
45786219 |
T |
 |
| Q |
223 |
c |
223 |
Q |
| |
|
| |
|
|
| T |
45786218 |
c |
45786218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 124 - 230
Target Start/End: Complemental strand, 46421139 - 46421031
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagcttt-agtgaaccgggttg |
221 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| || ||||||| ||| ||||||| | | ||||||||| |||||||| |||| ||||| ||| |
|
|
| T |
46421139 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttaagtgcaccggtttg |
46421040 |
T |
 |
| Q |
222 |
ccatttttt |
230 |
Q |
| |
|
|| |||||| |
|
|
| T |
46421039 |
ccctttttt |
46421031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 124 - 231
Target Start/End: Complemental strand, 49013577 - 49013469
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| || ||||||| ||| ||||||| | | || || || |||||||||||| |||||||||| |
|
|
| T |
49013577 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagtgcaccgggttgc |
49013478 |
T |
 |
| Q |
223 |
catttttta |
231 |
Q |
| |
|
| ||||||| |
|
|
| T |
49013477 |
cctttttta |
49013469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 124 - 230
Target Start/End: Complemental strand, 13730706 - 13730599
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||| || ||||||| ||| ||||||| | | || ||||| |||||||||||| |||||||||| |
|
|
| T |
13730706 |
cttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgc |
13730607 |
T |
 |
| Q |
223 |
catttttt |
230 |
Q |
| |
|
| |||||| |
|
|
| T |
13730606 |
cctttttt |
13730599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 124 - 211
Target Start/End: Complemental strand, 34420746 - 34420659
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtg |
211 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||| ||||||||| ||| ||||||| | | |||||||| |||||||||||| |
|
|
| T |
34420746 |
cttgtgtaaaaaacagggtaaggctgcgtaccatacaccaaaatggtgggaccccttcccggaccttgcgtatgtgggagctttagtg |
34420659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 124 - 231
Target Start/End: Complemental strand, 54374448 - 54374341
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| ||| ||||||||| ||| ||||||| | | ||| ||||| ||||||||||| ||| || |||| |
|
|
| T |
54374448 |
cttgtgtaaaaaatagggtaaggctgcgtacaatccaccaaaatggtgggaccccttcccggaccctgcatatgcgggagctttagttcaccaggctgcc |
54374349 |
T |
 |
| Q |
224 |
atttttta |
231 |
Q |
| |
|
|||||||| |
|
|
| T |
54374348 |
atttttta |
54374341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 131 - 229
Target Start/End: Original strand, 54484753 - 54484850
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattttt |
229 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| ||| ||||| ||| ||||||| | | ||||||||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
54484753 |
aaaaaacaaggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
54484850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 127 - 223
Target Start/End: Complemental strand, 353450 - 353353
Alignment:
| Q |
127 |
gtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||||| ||| ||||||| | | || ||||| |||||||||||| ||||||||||| |
|
|
| T |
353450 |
gtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcc |
353353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 148 - 217
Target Start/End: Complemental strand, 829521 - 829452
Alignment:
| Q |
148 |
tgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgg |
217 |
Q |
| |
|
|||||||||||||| ||||||||| ||| ||||||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
829521 |
tgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgcaccgg |
829452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 124 - 208
Target Start/End: Complemental strand, 8247791 - 8247706
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagcttta |
208 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| || ||||||| |||| ||||||| | | ||||||||| ||||||||| |
|
|
| T |
8247791 |
cttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggactccttcccggaccctgcgtatgcgggagcttta |
8247706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 124 - 220
Target Start/End: Original strand, 14987012 - 14987109
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggtt |
220 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| || ||||||| ||| |||||| | | ||| ||||| |||||||||||| |||||||| |
|
|
| T |
14987012 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcgggagctttagtgcaccgggtt |
14987109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 147 - 228
Target Start/End: Complemental strand, 25517249 - 25517169
Alignment:
| Q |
147 |
ctgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttt |
228 |
Q |
| |
|
||||||||||||||| ||||||||| ||| ||||||| ||| ||||||||| |||||||||||| ||||||||||| |||| |
|
|
| T |
25517249 |
ctgcgtacaatacac-aaaatggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccgggttgccctttt |
25517169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 124 - 228
Target Start/End: Complemental strand, 29366824 - 29366719
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| || ||||||| ||| ||||||| | | |||||||| |||||||||||| || ||||||| |
|
|
| T |
29366824 |
cttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcactgggttgc |
29366725 |
T |
 |
| Q |
223 |
catttt |
228 |
Q |
| |
|
| |||| |
|
|
| T |
29366724 |
cctttt |
29366719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 124 - 229
Target Start/End: Complemental strand, 53996668 - 53996563
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||| ||||||||| ||| |||||| | |||||||| |||||||||||| |||||| |||| |
|
|
| T |
53996668 |
cttgtgtaaaaaacagggtaaggctgcttacaatacaccaaaatggtgggaccccttccctgacactgcgtatgtgggagctttagtgcaccgggctgcc |
53996569 |
T |
 |
| Q |
224 |
attttt |
229 |
Q |
| |
|
||||| |
|
|
| T |
53996568 |
cttttt |
53996563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 132 - 223
Target Start/End: Original strand, 22609828 - 22609918
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
22609828 |
aaaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgcc |
22609918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 124 - 230
Target Start/End: Original strand, 7943045 - 7943150
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| | |||||||| || ||| || | | ||||||||| |||||||||||| || |||||||| |
|
|
| T |
7943045 |
cttgtctaaaaaacagggtaagactgcgtacaataca-tcaaatggtgggatccctttccagaccatgcgtatgcgggagctttagtgcactgggttgcc |
7943143 |
T |
 |
| Q |
224 |
atttttt |
230 |
Q |
| |
|
|||||| |
|
|
| T |
7943144 |
ttttttt |
7943150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 132 - 230
Target Start/End: Original strand, 26869769 - 26869866
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||| ||| ||| | | ||||||||| |||||||| ||| ||||||||||| |||||| |
|
|
| T |
26869769 |
aaaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttgccggaccatgcgtatgcgggagctttggtgcaccgggttgccctttttt |
26869866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 133 - 223
Target Start/End: Original strand, 31592911 - 31593000
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| |||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| |
|
|
| T |
31592911 |
aaaacagggtaaggctgcgtacaatacac-caaatggtgggactccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
31593000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 223
Target Start/End: Complemental strand, 10795527 - 10795427
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||| | ||||||||| ||| ||||| | | | ||||||||| ||||||| |||| ||| |||||| |
|
|
| T |
10795527 |
cttgtgtaaaagacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccaggttgc |
10795428 |
T |
 |
| Q |
223 |
c |
223 |
Q |
| |
|
| |
|
|
| T |
10795427 |
c |
10795427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 228
Target Start/End: Complemental strand, 12914137 - 12914034
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||| |||||||||||| |||||| | | ||| ||||| ||||||| | || ||||||||||| |
|
|
| T |
12914137 |
cttgtgtaaaaaacagggtaaggcggcgtacaatacac-caaatggtgagaccccttcccagaccctgcatatgcgggagcttcaatgcaccgggttgcc |
12914039 |
T |
 |
| Q |
224 |
atttt |
228 |
Q |
| |
|
|||| |
|
|
| T |
12914038 |
ctttt |
12914034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 124 - 171
Target Start/End: Original strand, 55401231 - 55401278
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtg |
171 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||| ||||||||| |
|
|
| T |
55401231 |
cttgtgtaaaaaacaggttaagactgcgtataatacaccaaaatggtg |
55401278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 133 - 231
Target Start/End: Original strand, 15797284 - 15797381
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttta |
231 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||| |||| |||||| ||||| ||||||||||| ||||||| |
|
|
| T |
15797284 |
aaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgccctttttta |
15797381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 133 - 223
Target Start/End: Original strand, 39203578 - 39203667
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||| |||||||||||||| ||| ||||| ||| ||||||| | | ||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
39203578 |
aaaacagggtaaggttgcgtacaatacaccaaa-tggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggttgcc |
39203667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 124 - 161
Target Start/End: Original strand, 9276319 - 9276356
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9276319 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacac |
9276356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 141 - 230
Target Start/End: Complemental strand, 52926304 - 52926216
Alignment:
| Q |
141 |
gtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
||||| ||||||||||||||| ||| ||||| ||| ||||||| | | ||||||||| |||||||||| | ||||||||||| |||||| |
|
|
| T |
52926304 |
gtaaggctgcgtacaatacaccaaa-tggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctttttt |
52926216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 229
Target Start/End: Original strand, 1217152 - 1217247
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattttt |
229 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||| | ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| ||||| |
|
|
| T |
1217152 |
aaaacagggtaaggctgcgtacaatacac-caaatggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
1217247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 125 - 161
Target Start/End: Complemental strand, 4495765 - 4495729
Alignment:
| Q |
125 |
ttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4495765 |
ttgtgtaaaaaacagggtaaggctgcgtacaatacac |
4495729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 229
Target Start/End: Complemental strand, 34771457 - 34771362
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattttt |
229 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||| ||||| |||||| ||||| |||||| |||| ||||| |
|
|
| T |
34771457 |
aaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgcccttttt |
34771362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 126 - 161
Target Start/End: Original strand, 26573184 - 26573219
Alignment:
| Q |
126 |
tgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26573184 |
tgtgtaaaaaacagggtaaggctgcgtacaatacac |
26573219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 223
Target Start/End: Complemental strand, 22123010 - 22122921
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||| ||||| ||||| ||||| ||||||||||| |
|
|
| T |
22123010 |
aaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttgcc |
22122921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 164 - 230
Target Start/End: Complemental strand, 24851364 - 24851298
Alignment:
| Q |
164 |
aaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
|||||||| ||| ||||||| ||| ||| ||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
24851364 |
aaatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgccctttttt |
24851298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 165
Target Start/End: Original strand, 33235594 - 33235628
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaatacactaaa |
165 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33235594 |
aaaaaacagggtaagactgtgtacaatacactaaa |
33235628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 190 - 231
Target Start/End: Complemental strand, 4495713 - 4495672
Alignment:
| Q |
190 |
tgcgtatgcaggagctttagtgaaccgggttgccatttttta |
231 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| ||||||| |
|
|
| T |
4495713 |
tgcgtatgcgggagctttagtgcaccgggttgccctttttta |
4495672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 128 - 161
Target Start/End: Complemental strand, 31904955 - 31904922
Alignment:
| Q |
128 |
tgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
31904955 |
tgtaaaaaacagggtatgactgcgtacaatacac |
31904922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 124 - 161
Target Start/End: Complemental strand, 52428579 - 52428542
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
52428579 |
cttgtgtaaaatacagggtaaggctgcgtacaatacac |
52428542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 124 - 161
Target Start/End: Complemental strand, 54032661 - 54032624
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
54032661 |
cttgtgtaaaaaacagggtaaggctgcatacaatacac |
54032624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 228
Target Start/End: Original strand, 16735503 - 16735598
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttt |
228 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | ||||||||| | ||||| |||| || |||||||| |||| |
|
|
| T |
16735503 |
aaaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgccctttt |
16735598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 160
Target Start/End: Original strand, 39212045 - 39212081
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaataca |
160 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
39212045 |
cttgtgtaaataacaaggtaagactgcgtacaataca |
39212081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 230
Target Start/End: Original strand, 40390361 - 40390401
Alignment:
| Q |
190 |
tgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
40390361 |
tgcgtatgcgggagctttagtgcaccgggttgccctttttt |
40390401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 230
Target Start/End: Original strand, 47624219 - 47624259
Alignment:
| Q |
190 |
tgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
47624219 |
tgcgtatgcgggagctttagtgcaccgggttgccctttttt |
47624259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 34)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 124 - 228
Target Start/End: Complemental strand, 39461098 - 39460993
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| || ||||||||||| ||||||| | | ||||||||| |||||||||||| |||||||||| |
|
|
| T |
39461098 |
cttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgc |
39460999 |
T |
 |
| Q |
223 |
catttt |
228 |
Q |
| |
|
| |||| |
|
|
| T |
39460998 |
cctttt |
39460993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 125 - 223
Target Start/End: Original strand, 33866983 - 33867083
Alignment:
| Q |
125 |
ttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaaa-tggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||| |||| |||||| ||||||||||||| | ||||||||||| |||||||||| |||||||||| |
|
|
| T |
33866983 |
ttgtgtaaaaaagcagggtaagactgcatacaatacataaaaaatggtgacacttcttcccgaaccctgcgtatgcagaagctttagtgcaccgggttgc |
33867082 |
T |
 |
| Q |
223 |
c |
223 |
Q |
| |
|
| |
|
|
| T |
33867083 |
c |
33867083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 124 - 231
Target Start/End: Original strand, 35261712 - 35261818
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||| ||| ||||| | | | ||||||||| |||||||||||| ||||||||||| |
|
|
| T |
35261712 |
cttgtgtaaaaaacagggtaaggttgcgtacaatacac-caaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
35261810 |
T |
 |
| Q |
224 |
atttttta |
231 |
Q |
| |
|
||||||| |
|
|
| T |
35261811 |
ctttttta |
35261818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 124 - 229
Target Start/End: Complemental strand, 28817728 - 28817624
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||| ||| ||||||| | | ||||||||| |||||||||||| | ||||||||| |
|
|
| T |
28817728 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacac-ccaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttgcc |
28817630 |
T |
 |
| Q |
224 |
attttt |
229 |
Q |
| |
|
||||| |
|
|
| T |
28817629 |
cttttt |
28817624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 124 - 221
Target Start/End: Original strand, 44530182 - 44530278
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttg |
221 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||| ||| ||||| | | | ||||||||| |||||||||||| ||||||||| |
|
|
| T |
44530182 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttg |
44530278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 124 - 228
Target Start/End: Original strand, 36720829 - 36720932
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||||||||| | |||||||||| ||| ||||||| |
|
|
| T |
36720829 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcacccggttgcc |
36720927 |
T |
 |
| Q |
224 |
atttt |
228 |
Q |
| |
|
|||| |
|
|
| T |
36720928 |
ctttt |
36720932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 124 - 223
Target Start/End: Original strand, 17823609 - 17823707
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||| |||| |||||||||||| ||||||| ||| ||||| || ||||||||| | ||| |||||||||||||||||| ||||||||||| |
|
|
| T |
17823609 |
cttgtgtaaaaaccaggataagactgcgtaaaatacaccaaa-tggtggaaccccttcccgaaccctgcatatgcaggagctttagtgcaccgggttgcc |
17823707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 124 - 230
Target Start/End: Original strand, 20869956 - 20870063
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| || ||||||| ||| ||||| | | | || ||||| |||||||||||| |||||||||| |
|
|
| T |
20869956 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagctttagtgcaccgggttgc |
20870055 |
T |
 |
| Q |
223 |
catttttt |
230 |
Q |
| |
|
| |||||| |
|
|
| T |
20870056 |
cctttttt |
20870063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 131 - 228
Target Start/End: Original strand, 12625930 - 12626026
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttt |
228 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| ||| | ||||| | | ||||||||| |||||||||||| ||||||||||| |||| |
|
|
| T |
12625930 |
aaaaaacagggtaagactgcatacaatacac-caaatggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
12626026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 124 - 230
Target Start/End: Original strand, 6760855 - 6760962
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||| || ||||||| ||| |||| || | | || ||||| |||||||||||| |||||||||| |
|
|
| T |
6760855 |
cttgtgtaaaaaacagggtaaggcttcgtacaatacaccaataatggtgggaccccttctcggaccccgcatatgcgggagctttagtgcaccgggttgc |
6760954 |
T |
 |
| Q |
223 |
catttttt |
230 |
Q |
| |
|
| |||||| |
|
|
| T |
6760955 |
cctttttt |
6760962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 124 - 230
Target Start/End: Complemental strand, 7136631 - 7136524
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||| || ||||||| ||| ||||||| | | || ||||| |||||||||||| |||||||| | |
|
|
| T |
7136631 |
cttgtgtaaaaaccagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttac |
7136532 |
T |
 |
| Q |
223 |
catttttt |
230 |
Q |
| |
|
| |||||| |
|
|
| T |
7136531 |
cctttttt |
7136524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 124 - 171
Target Start/End: Complemental strand, 14018071 - 14018024
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtg |
171 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
14018071 |
cttgtgtaaaaaacagggtgagactgcgtacaatacactaaattggtg |
14018024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 132 - 223
Target Start/End: Original strand, 45071305 - 45071395
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
45071305 |
aaaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgcc |
45071395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 124 - 222
Target Start/End: Original strand, 5689664 - 5689761
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||| |||||||| || ||||||||| | |||||||| |||||||||||| ||||| |||| |
|
|
| T |
5689664 |
cttgtgtaaaaagcagggtaaggctgcgtacaatacac-caaatggtggaaccccttcccgaaccatgcgtatgtgggagctttagtgcaccggtttgc |
5689761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 128 - 221
Target Start/End: Original strand, 16225056 - 16225150
Alignment:
| Q |
128 |
tgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||| || ||||||| | | || ||||| |||||||||||| ||||||||| |
|
|
| T |
16225056 |
tgtaaaaaacagggtaagactgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcaccgggttg |
16225150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 125 - 211
Target Start/End: Original strand, 29877128 - 29877213
Alignment:
| Q |
125 |
ttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtg |
211 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||||||||| ||||| |||||| |
|
|
| T |
29877128 |
ttgtgtaaaaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcgtatgcgggagcgttagtg |
29877213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 124 - 229
Target Start/End: Complemental strand, 5135391 - 5135288
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||||||| |||||||| ||| ||||||| | | |||||||||||||||||| ||| |||||| |||| |
|
|
| T |
5135391 |
cttgtgtaaaaaagagggtaaggctgtgtacaatacac-caaatggtgggaccccttcccggaccctgcgtatgcaggagcttt-gtgcaccgggctgcc |
5135294 |
T |
 |
| Q |
224 |
attttt |
229 |
Q |
| |
|
||||| |
|
|
| T |
5135293 |
cttttt |
5135288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 125 - 229
Target Start/End: Original strand, 25250556 - 25250661
Alignment:
| Q |
125 |
ttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||||| || ||||||| ||| ||||||||| | || ||||| |||| ||||||| ||||||||||| |
|
|
| T |
25250556 |
ttgtgtaaaaaatagggtatggctgcgtacaatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagatttagtgcaccgggttgcc |
25250655 |
T |
 |
| Q |
224 |
attttt |
229 |
Q |
| |
|
||||| |
|
|
| T |
25250656 |
cttttt |
25250661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 126 - 171
Target Start/End: Complemental strand, 44742619 - 44742574
Alignment:
| Q |
126 |
tgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtg |
171 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
44742619 |
tgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtg |
44742574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 211
Target Start/End: Complemental strand, 17250979 - 17250891
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtg |
211 |
Q |
| |
|
||||||||||||||||| |||| | ||||||||||||| || ||||||| ||| |||||||| | |||||||| ||||||||||||| |
|
|
| T |
17250979 |
cttgtgtaaaaaacaggttaaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaaggagctttagtg |
17250891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 132 - 223
Target Start/End: Original strand, 13160742 - 13160832
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||||||||| ||||||| |||| |||||||||| |
|
|
| T |
13160742 |
aaaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttgcc |
13160832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 131 - 221
Target Start/End: Complemental strand, 20284166 - 20284075
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttg |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||| || ||||||| ||| ||||||| | | ||||||||| |||| ||||||| ||||||||| |
|
|
| T |
20284166 |
aaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg |
20284075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 131 - 221
Target Start/End: Complemental strand, 21070794 - 21070703
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttg |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||| || ||||||| ||| ||||||| | | ||||||||| |||| ||||||| ||||||||| |
|
|
| T |
21070794 |
aaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg |
21070703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 124 - 230
Target Start/End: Complemental strand, 8897866 - 8897761
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||| |||||||| || |||||||||||| |||||||| ||| ||||||| | | ||| ||||| ||||||||| || ||| ||||||| |
|
|
| T |
8897866 |
cttgtgtaaaaaatagggtaaggctacgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgcgggagctttactgcacccggttgcc |
8897768 |
T |
 |
| Q |
224 |
atttttt |
230 |
Q |
| |
|
|||||| |
|
|
| T |
8897767 |
ctttttt |
8897761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 124 - 222
Target Start/End: Complemental strand, 29521787 - 29521690
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||||||| || | |||| | | ||||||||| |||||||||||| |||||||||| |
|
|
| T |
29521787 |
cttgtttaaaaaacagggtaaggctgcgtacaatacac-caaatggtgggaacccatcccagaccctgcgtatgcgggagctttagtgcaccgggttgc |
29521690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 230
Target Start/End: Complemental strand, 12670343 - 12670247
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||| ||||| |||||| ||||| |||||||| || |||||| |
|
|
| T |
12670343 |
aaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttaccctttttt |
12670247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 132 - 229
Target Start/End: Complemental strand, 18164854 - 18164758
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattttt |
229 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| | || ||| |||||| | | ||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
18164854 |
aaaaacagggtaaggttgcgtacaatacaccaaag-gatgtgaccatttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccattttt |
18164758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 161
Target Start/End: Original strand, 2626562 - 2626592
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2626562 |
aaaaaacagggtaagactgcgtacaatacac |
2626592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 228
Target Start/End: Original strand, 26954173 - 26954271
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttt |
228 |
Q |
| |
|
||||||||||||||| ||||||||||||||| || ||||||| ||| |||||| | | || ||||| |||||||||||| || |||||||| |||| |
|
|
| T |
26954173 |
aaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagacctcgcatatgcgggagctttagtgcactgggttgccctttt |
26954271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 230
Target Start/End: Complemental strand, 27468143 - 27468089
Alignment:
| Q |
176 |
ttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
||||||||| | | ||||||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
27468143 |
ttcttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt |
27468089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 124 - 161
Target Start/End: Complemental strand, 8484040 - 8484003
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
8484040 |
cttgtgtaaaaaacagggcaaggctgcgtacaatacac |
8484003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 133 - 230
Target Start/End: Complemental strand, 30454190 - 30454094
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
|||||| |||||| |||||||| |||||| ||| ||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| |||||| |
|
|
| T |
30454190 |
aaaacaaggtaaggctgcgtacgatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
30454094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 166 - 223
Target Start/End: Complemental strand, 36486627 - 36486570
Alignment:
| Q |
166 |
atggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||| ||| |||||||| | | |||||||||||||||||||||| |||||||||| |
|
|
| T |
36486627 |
atggtgggacctcttcccggaccttgcgtatgcaggagctttagtgccccgggttgcc |
36486570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 230
Target Start/End: Complemental strand, 950646 - 950591
Alignment:
| Q |
175 |
cttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttg-ccatttttt |
230 |
Q |
| |
|
||||||||||| || ||| |||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
950646 |
cttcttcccgactc-tgcatatgcaggagctttagtgcaccgggttgtccatttttt |
950591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 24)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 125 - 230
Target Start/End: Original strand, 24448924 - 24449028
Alignment:
| Q |
125 |
ttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcca |
224 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||| ||| ||||| ||| ||||||| | | |||||||||||||||||||||| ||||||||||| |
|
|
| T |
24448924 |
ttgtgtaaaaaatagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttgccc |
24449022 |
T |
 |
| Q |
225 |
tttttt |
230 |
Q |
| |
|
|||||| |
|
|
| T |
24449023 |
tttttt |
24449028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 124 - 228
Target Start/End: Original strand, 38879614 - 38879719
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| || ||||||| ||| ||||||| | | ||||||||| |||||||||||| |||||||||| |
|
|
| T |
38879614 |
cttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgc |
38879713 |
T |
 |
| Q |
223 |
catttt |
228 |
Q |
| |
|
| |||| |
|
|
| T |
38879714 |
cctttt |
38879719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 220
Target Start/End: Complemental strand, 16880749 - 16880654
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggtt |
220 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||||||||| |||||||||||| |||||||| |
|
|
| T |
16880749 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacac-caaatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccgggtt |
16880654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 124 - 208
Target Start/End: Original strand, 27328785 - 27328870
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagcttta |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| || ||||||| ||| ||||||||| | ||||||||| ||||||||| |
|
|
| T |
27328785 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccgaaccctgcgtatgcgggagcttta |
27328870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 124 - 228
Target Start/End: Complemental strand, 4619208 - 4619103
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| || ||||||| ||| ||||||| | | || ||||| ||||||||||| |||||||||| |
|
|
| T |
4619208 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgc |
4619109 |
T |
 |
| Q |
223 |
catttt |
228 |
Q |
| |
|
| |||| |
|
|
| T |
4619108 |
cctttt |
4619103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 223
Target Start/End: Complemental strand, 13801871 - 13801771
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| || ||||||| ||| ||||||| | | || ||||| ||||||||||| |||||||||| |
|
|
| T |
13801871 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgc |
13801772 |
T |
 |
| Q |
223 |
c |
223 |
Q |
| |
|
| |
|
|
| T |
13801771 |
c |
13801771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 223
Target Start/End: Original strand, 20135637 - 20135737
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||| || ||||||| ||| ||||||| | | || ||||||||||||| |||| |||||||||| |
|
|
| T |
20135637 |
cttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttcagtgcaccgggttgc |
20135736 |
T |
 |
| Q |
223 |
c |
223 |
Q |
| |
|
| |
|
|
| T |
20135737 |
c |
20135737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 132 - 211
Target Start/End: Complemental strand, 7097854 - 7097776
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtg |
211 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| ||||||||| ||||||||| | ||||||||| |||||||||||| |
|
|
| T |
7097854 |
aaaaacagggtaaggttgcgtacaatacaccaaa-tggtgagaccccttcccgaaccctgcgtatgcgggagctttagtg |
7097776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 131 - 229
Target Start/End: Original strand, 43334243 - 43334341
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaataca-ctaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattttt |
229 |
Q |
| |
|
||||||||||||||| |||||||||||||| | ||||||||| ||| ||||||| | | |||| |||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
43334243 |
aaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcg-atgcgggagctttagtgcaccgggttgcccttttt |
43334341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 228
Target Start/End: Complemental strand, 28516536 - 28516432
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||||||| || | |||||||||||||| ||||||||| ||| ||||| | | |||| ||||||||||||||||| ||| ||||||| |
|
|
| T |
28516536 |
cttgtgtaaaaaacaggctagggctgcgtacaatacatcaaaatggtgggacccattcccagaccctgcgcatgcaggagctttagtggaccaggttgcc |
28516437 |
T |
 |
| Q |
224 |
atttt |
228 |
Q |
| |
|
|||| |
|
|
| T |
28516436 |
ctttt |
28516432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 133 - 228
Target Start/End: Original strand, 32703464 - 32703558
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttt |
228 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| |||| |
|
|
| T |
32703464 |
aaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
32703558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 124 - 218
Target Start/End: Original strand, 43574639 - 43574732
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccggg |
218 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||| || |||||||| ||| ||||||| | | ||||||||| |||||||||| | |||||| |
|
|
| T |
43574639 |
cttgtgtagaaaacagggtaaggctgcgtacaatatac-caaatggtgggaccccttcccggaccctgcgtatgcgggagctttagagcaccggg |
43574732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 142 - 211
Target Start/End: Complemental strand, 12477205 - 12477136
Alignment:
| Q |
142 |
taagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtg |
211 |
Q |
| |
|
|||| ||||||||||||||| ||||||||| ||| ||||||| || |||||||||| ||||||||||| |
|
|
| T |
12477205 |
taaggctgcgtacaatacaccaaaatggtgggaccccttcccggattctgcgtatgcaagagctttagtg |
12477136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 229
Target Start/End: Complemental strand, 8170077 - 8169982
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattttt |
229 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||| ||||| |||| || |||| ||||||||||| ||||| |
|
|
| T |
8170077 |
aaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttgcccttttt |
8169982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 228
Target Start/End: Original strand, 29334428 - 29334532
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||| | ||||||| ||| |||||| | | |||||||| ||| ||||| || |||||| |||| |
|
|
| T |
29334428 |
cttgtgtaaaaaacaaggtaaggctgcgtacaatacaccagaatggtgggacccattcccggaccctgcgtatgtgggatctttaatgcaccgggctgcc |
29334527 |
T |
 |
| Q |
224 |
atttt |
228 |
Q |
| |
|
|||| |
|
|
| T |
29334528 |
ctttt |
29334532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 148 - 223
Target Start/End: Complemental strand, 12575739 - 12575664
Alignment:
| Q |
148 |
tgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||| ||||||||| ||| ||||| | | | |||||||||||||||||| ||| |||||| |||| |
|
|
| T |
12575739 |
tgcgtacaatacaccaaaatggtgggaccccttcctggaccctgcgtatgcaggagctttggtgcaccgggctgcc |
12575664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 218
Target Start/End: Complemental strand, 209022 - 208936
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccggg |
218 |
Q |
| |
|
|||||||||||||| |||| | |||||||| ||||||||| ||| ||||| | | | || ||||||| ||||||||||| |||||| |
|
|
| T |
209022 |
aaaaacagggtaaggctgcattcaatacaccaaaatggtgggaccccttcctggaccctgggtatgcaagagctttagtgcaccggg |
208936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 166
Target Start/End: Original strand, 22187318 - 22187360
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaa |
166 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||| |||| |
|
|
| T |
22187318 |
cttgtgtaaaaaacatgataagactgcgtacaatacaccaaaa |
22187360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 125 - 207
Target Start/End: Original strand, 22600488 - 22600569
Alignment:
| Q |
125 |
ttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagcttt |
207 |
Q |
| |
|
|||||||||| |||||||||| ||| ||||||||||| |||||||| || ||||||| ||| ||||||||| |||||||| |
|
|
| T |
22600488 |
ttgtgtaaaacacagggtaaggctgtgtacaatacac-caaatggtgggatcccttcccggatcctgcgtatgcgggagcttt |
22600569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 166
Target Start/End: Complemental strand, 42924936 - 42924894
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaa |
166 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
42924936 |
cttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaaa |
42924894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 228
Target Start/End: Original strand, 16957374 - 16957450
Alignment:
| Q |
151 |
gtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttt |
228 |
Q |
| |
|
||||||||||| ||| ||||| ||| ||||||| | | ||||||||| |||||||||||| ||||||||||| |||| |
|
|
| T |
16957374 |
gtacaatacaccaaa-tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
16957450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 133 - 230
Target Start/End: Original strand, 35710353 - 35710449
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
|||| |||||||| |||||| |||||||| ||| ||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| |||||| |
|
|
| T |
35710353 |
aaaatagggtaaggctgcgttcaatacaccaaa-tggtgggaccccttcccggaacatgcatatgcgggagctctagtgcaccgggttgccctttttt |
35710449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 192 - 228
Target Start/End: Original strand, 39801616 - 39801652
Alignment:
| Q |
192 |
cgtatgcaggagctttagtgaaccgggttgccatttt |
228 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
39801616 |
cgtatgcgggagctttagtgcaccgggttgccatttt |
39801652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 125 - 161
Target Start/End: Original strand, 41425982 - 41426018
Alignment:
| Q |
125 |
ttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
41425982 |
ttgtgtaaaaaacagggtaaggctgcatacaatacac |
41426018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 26)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 223
Target Start/End: Original strand, 10543731 - 10543831
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| | ||||||||| ||| ||||||| | | ||||||||| |||||||||||| |||||||||| |
|
|
| T |
10543731 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgc |
10543830 |
T |
 |
| Q |
223 |
c |
223 |
Q |
| |
|
| |
|
|
| T |
10543831 |
c |
10543831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 228
Target Start/End: Complemental strand, 8455418 - 8455315
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||||||||| |||||||||||| ||||||||||| |
|
|
| T |
8455418 |
cttgtgtaaaacacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttgcc |
8455320 |
T |
 |
| Q |
224 |
atttt |
228 |
Q |
| |
|
|||| |
|
|
| T |
8455319 |
ctttt |
8455315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 131 - 230
Target Start/End: Original strand, 10546203 - 10546301
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||| ||| ||||||| | | ||||||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
10546203 |
aaaaaacagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt |
10546301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 126 - 223
Target Start/End: Original strand, 25632544 - 25632640
Alignment:
| Q |
126 |
tgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| |||||||| || | ||||||||| | | ||||||| |||||||||||| ||||||||||| |
|
|
| T |
25632544 |
tgtgtaaaaaacaggataaggctgcgtacaatacac-caaatggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgcc |
25632640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 124 - 223
Target Start/End: Original strand, 14530351 - 14530451
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
||||| |||||||||||||||| || |||||||||||| || ||||||| ||| ||||||| | | ||||||||| |||||||||||| |||||||||| |
|
|
| T |
14530351 |
cttgtataaaaaacagggtaaggctacgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgc |
14530450 |
T |
 |
| Q |
223 |
c |
223 |
Q |
| |
|
| |
|
|
| T |
14530451 |
c |
14530451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 133 - 228
Target Start/End: Original strand, 9671221 - 9671315
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttt |
228 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||| ||||| ||| ||||||| | | ||||||||| |||||||||||| ||||||||||| |||| |
|
|
| T |
9671221 |
aaaacagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
9671315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 124 - 231
Target Start/End: Original strand, 17623597 - 17623703
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||| |||||||| || ||||||||||| |||||||| | |||||||||| || |||||||| |
|
|
| T |
17623597 |
cttgtgtaaaaatcagggtaaggctgcgtacaatacac-caaatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcactgggttgcc |
17623695 |
T |
 |
| Q |
224 |
atttttta |
231 |
Q |
| |
|
||||||| |
|
|
| T |
17623696 |
ctttttta |
17623703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 230
Target Start/End: Original strand, 36871534 - 36871629
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||| ||||| ||| ||||||| | | ||||||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
36871534 |
aaaacagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggacc-tgcgtatgcgggagctttagtgcaccgggttgccctttttt |
36871629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 211
Target Start/End: Original strand, 19615025 - 19615112
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtg |
211 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| || || ||| ||| ||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
19615025 |
cttgtataaaaaacagggtaagactgcgtacaatataccaataatagtg-gaccccttcccgaaccctgcgtatgcaggagctttagtg |
19615112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 230
Target Start/End: Complemental strand, 25249830 - 25249735
Alignment:
| Q |
134 |
aaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| ||||| || ||||||||| | ||||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
25249830 |
aaacagggtaaggctgcgtacaatacaccaaa-tggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccgggttgccctttttt |
25249735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 124 - 231
Target Start/End: Original strand, 17668035 - 17668141
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||| |||||||| || |||| |||| | ||||||| |||||||||||| ||||||||||| |
|
|
| T |
17668035 |
cttgtgtaaaaatcagggtaaggctgcgtacaatacac-caaatggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccgggttgcc |
17668133 |
T |
 |
| Q |
224 |
atttttta |
231 |
Q |
| |
|
||||||| |
|
|
| T |
17668134 |
ctttttta |
17668141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 124 - 228
Target Start/End: Complemental strand, 24200727 - 24200622
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaa-tggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||| ||||| || ||||||| | | || ||||| ||||||||||| |||||||||| |
|
|
| T |
24200727 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaacccttcccggaccctgagtatgtgagagctttagtgcaccgggttgc |
24200628 |
T |
 |
| Q |
223 |
catttt |
228 |
Q |
| |
|
| |||| |
|
|
| T |
24200627 |
cctttt |
24200622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 124 - 161
Target Start/End: Complemental strand, 32781390 - 32781353
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32781390 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
32781353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 132 - 230
Target Start/End: Original strand, 14444769 - 14444866
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
|||||||||||||| ||| |||| |||||| ||| ||||| ||| ||||||| | | ||||||||| |||||||||||| ||| ||||||| |||||| |
|
|
| T |
14444769 |
aaaaacagggtaaggctgtgtacgatacaccaaa-tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgccctttttt |
14444866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 131 - 217
Target Start/End: Complemental strand, 26684715 - 26684630
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgg |
217 |
Q |
| |
|
|||||| | |||||| |||||||||||| ||| |||||||| ||| |||||||||| | ||||||||| ||||||||| || ||||| |
|
|
| T |
26684715 |
aaaaaatatggtaaggctgcgtacaatatact-aaatggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccgg |
26684630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 230
Target Start/End: Original strand, 25641543 - 25641639
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
|||||||||||| |||||||||||||| ||| || || ||| ||||||||||| ||||||||| ||||||||||||||||| ||| | |||||| |
|
|
| T |
25641543 |
aaaacagggtaaagttgcgtacaatacaccaaattg-tgggaccccttcccgaatcctgcgtatgcgagagctttagtgaaccggattgtcctttttt |
25641639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 131 - 223
Target Start/End: Complemental strand, 25079812 - 25079721
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||| |||||| |||||||||||||| || ||||| ||| ||||||| | | |||||||||| ||||||||||| ||||||||||| |
|
|
| T |
25079812 |
aaaaaacaaggtaaggatgcgtacaatacaccgaa-tggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttgcc |
25079721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 124 - 174
Target Start/End: Original strand, 7214567 - 7214618
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac-taaaatggtgaga |
174 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
7214567 |
cttgtgtaaaatacagggtaaggctgcgtacaatacacaaaaaatggtgaga |
7214618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 124 - 207
Target Start/End: Complemental strand, 21377175 - 21377093
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagcttt |
207 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||| ||| |||||||| ||| ||||||||| | |||||||| |||||||| |
|
|
| T |
21377175 |
cttgtgtaaaaaacagggtaaggctgggtacaatgcac-caaatggtgggaccccttcccgaaccctgcgtatgtgggagcttt |
21377093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 133 - 228
Target Start/End: Complemental strand, 21779354 - 21779260
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttt |
228 |
Q |
| |
|
||||||||||||| |||||||||||||| ||| ||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| |||| |
|
|
| T |
21779354 |
aaaacagggtaaggttgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
21779260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 217
Target Start/End: Original strand, 17471589 - 17471675
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgg |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||| || |||||| |||||| |||||| | | ||| ||||| |||| ||||||| ||||| |
|
|
| T |
17471589 |
aaaaaacaggataagactgcgtacaatataccaaaatgatgagaccccttccctgaccctgcctatgcgggagttttagtgcaccgg |
17471675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 124 - 161
Target Start/End: Complemental strand, 23145800 - 23145763
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
23145800 |
cttgtgtaaaaaacagtgtaaggctgcgtacaatacac |
23145763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 124 - 161
Target Start/End: Complemental strand, 23557590 - 23557553
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
23557590 |
cttgtgtaaaaaacagtgtaaggctgcgtacaatacac |
23557553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 125 - 228
Target Start/End: Original strand, 5841062 - 5841166
Alignment:
| Q |
125 |
ttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| | | ||||||| ||| ||||||| | | || ||||| |||||||||||| |||| |||||| |
|
|
| T |
5841062 |
ttgtgtaaaaaatagggtaaggatgcgtacaatacatcaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcc |
5841161 |
T |
 |
| Q |
224 |
atttt |
228 |
Q |
| |
|
|||| |
|
|
| T |
5841162 |
ctttt |
5841166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 182
Target Start/End: Complemental strand, 12315748 - 12315697
Alignment:
| Q |
130 |
taaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcc |
182 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||| |||||||| ||||| |
|
|
| T |
12315748 |
taaaaaacagggtaagactgtgtacaatacac-caaatagtgagactccttcc |
12315697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 211
Target Start/End: Original strand, 24890451 - 24890530
Alignment:
| Q |
131 |
aaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtg |
211 |
Q |
| |
|
|||||||| |||||| |||| |||||||||| || ||||| ||| ||||||| | | |||||||||||||||||||||| |
|
|
| T |
24890451 |
aaaaaacaaggtaaggctgcatacaatacaccaat-tggtgggaccccttcccggaccctgcgtatgcaggagctttagtg |
24890530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 52; Significance: 6e-21; HSPs: 36)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 124 - 223
Target Start/End: Complemental strand, 11617690 - 11617592
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||| ||||| | | | ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
11617690 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac-caaatggtgggaccccttcctggaccctgcgtatgcaggacctttagtgcaccgggttgcc |
11617592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 124 - 230
Target Start/End: Original strand, 7879671 - 7879776
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||| |||||||| ||| ||||||| | | ||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
7879671 |
cttgtgtaaaaaacaaggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcaccgggttgcc |
7879769 |
T |
 |
| Q |
224 |
atttttt |
230 |
Q |
| |
|
|||||| |
|
|
| T |
7879770 |
ctttttt |
7879776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 124 - 218
Target Start/End: Original strand, 21566468 - 21566562
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccggg |
218 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||| |||||||| ||| ||||||||| | ||| ||||| |||||||||||| |||||| |
|
|
| T |
21566468 |
cttgtgtaaaaaacagaggaagactgcgtacaatacaccaaaatggtaggaccccttcccgaaccctgcatatgcgggagctttagtgcaccggg |
21566562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 220
Target Start/End: Complemental strand, 35334915 - 35334823
Alignment:
| Q |
127 |
gtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggtt |
220 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||| ||| ||||||| | | |||||||||||||||||||||| |||||||| |
|
|
| T |
35334915 |
gtgtaaaaaacagggtaagactgtgtacaatacac-cgaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggtt |
35334823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 124 - 229
Target Start/End: Original strand, 42805557 - 42805663
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||| || ||||||| ||| ||||||| | | || ||||| |||||||||||| |||||||||| |
|
|
| T |
42805557 |
cttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgc |
42805656 |
T |
 |
| Q |
223 |
cattttt |
229 |
Q |
| |
|
| ||||| |
|
|
| T |
42805657 |
ccttttt |
42805663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 220
Target Start/End: Complemental strand, 2541121 - 2541026
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggtt |
220 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||| |||||||| ||| ||||||| | ||||||||| |||||||||||| |||||||| |
|
|
| T |
2541121 |
cttgtgtaaaaaacagggtaaggctgcgtactatacac-caaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggtt |
2541026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 223
Target Start/End: Original strand, 47716492 - 47716592
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| || ||||||| ||| ||||||| | | || ||||| |||||||| ||| |||||||||| |
|
|
| T |
47716492 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttggtgcaccgggttgc |
47716591 |
T |
 |
| Q |
223 |
c |
223 |
Q |
| |
|
| |
|
|
| T |
47716592 |
c |
47716592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 125 - 203
Target Start/End: Complemental strand, 14099107 - 14099030
Alignment:
| Q |
125 |
ttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggag |
203 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||| ||| ||||||||| | | |||||||||||| |
|
|
| T |
14099107 |
ttgtgtaaaaaacaggttaagactgcgtacaatacac-caaatggtgggaccccttcccgaaccctacgtatgcaggag |
14099030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 125 - 203
Target Start/End: Complemental strand, 14409124 - 14409047
Alignment:
| Q |
125 |
ttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggag |
203 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||| ||| ||||||||| | | |||||||||||| |
|
|
| T |
14409124 |
ttgtgtaaaaaacaggttaagactgcgtacaatacac-caaatggtgggaccccttcccgaaccctacgtatgcaggag |
14409047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 128 - 230
Target Start/End: Complemental strand, 17048914 - 17048812
Alignment:
| Q |
128 |
tgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattt |
227 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| ||||||||| || ||||||| | | ||| |||| ||||||||||||||||| | |||||||| |
|
|
| T |
17048914 |
tgtaaaaaacagggtaaggttacgtacaatacaccaaaatggtggaaccccttcccggaacttgcttatgtaggagctttagtgaaccaagctgccattt |
17048815 |
T |
 |
| Q |
228 |
ttt |
230 |
Q |
| |
|
||| |
|
|
| T |
17048814 |
ttt |
17048812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 124 - 166
Target Start/End: Complemental strand, 22699072 - 22699030
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaa |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22699072 |
cttgtgtaaaaaacagggtaagactgcgtacaatacaccaaaa |
22699030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 124 - 161
Target Start/End: Complemental strand, 23419776 - 23419739
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23419776 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
23419739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 133 - 230
Target Start/End: Complemental strand, 42391193 - 42391097
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| |||||| |
|
|
| T |
42391193 |
aaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
42391097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 184
Target Start/End: Original strand, 16341311 - 16341371
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccg |
184 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||| ||||||||| | | |||||||| |
|
|
| T |
16341311 |
cttgtgtaaaaaacagggtaaggctacgtacaatacaccaaaatggtgggccctcttcccg |
16341371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 230
Target Start/End: Original strand, 43557505 - 43557613
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaa-aatggtgagacttcttcccgaatcgtgcgtatgcaggagc-tttagtgaaccgggttg |
221 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| || ||||||| ||| | ||||| | ||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
43557505 |
cttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgggaccccctcccggactctgcgtatgcgggagcttttagtgcaccgggttg |
43557604 |
T |
 |
| Q |
222 |
ccatttttt |
230 |
Q |
| |
|
|| |||||| |
|
|
| T |
43557605 |
ccctttttt |
43557613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 133 - 228
Target Start/End: Complemental strand, 21172102 - 21172008
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttt |
228 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| |||| |
|
|
| T |
21172102 |
aaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
21172008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 128 - 217
Target Start/End: Complemental strand, 14732920 - 14732831
Alignment:
| Q |
128 |
tgtaaaaaacagggtaagactgcgtacaatacactaaaa-tggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgg |
217 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| |||| |||||| ||| ||||||||| | || ||||| |||||||||||| ||||| |
|
|
| T |
14732920 |
tgtaaaaaacagggtaaggctgcgt-caatacaccaaaaatggtgaaactccttcccgaaccctgtttatgcgggagctttagtgcaccgg |
14732831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 124 - 230
Target Start/End: Complemental strand, 19426991 - 19426887
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||| ||| |||| || | | ||| ||||| |||||| |||| ||||||||||| |
|
|
| T |
19426991 |
cttgtgtaaaaaatagggtaagactgcgtacaatacac-caaatggtgggac-ccttctcggaccctgcatatgcgagagcttcagtgcaccgggttgcc |
19426894 |
T |
 |
| Q |
224 |
atttttt |
230 |
Q |
| |
|
|||||| |
|
|
| T |
19426893 |
ctttttt |
19426887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 230
Target Start/End: Original strand, 32758301 - 32758397
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||| ||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| |||||| |
|
|
| T |
32758301 |
aaaacagggtaaggctgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
32758397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 124 - 229
Target Start/End: Original strand, 42798702 - 42798806
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||| |||||||| ||| |||||| | | ||| ||||| |||||| ||||| | ||||||||| |
|
|
| T |
42798702 |
cttgtgtaaaaaacaaggtaaggctgcgtacaatacac-caaatggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggttgcc |
42798800 |
T |
 |
| Q |
224 |
attttt |
229 |
Q |
| |
|
||||| |
|
|
| T |
42798801 |
cttttt |
42798806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 124 - 161
Target Start/End: Original strand, 46354227 - 46354264
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46354227 |
cttgtgtaaaaaacagggtaaggctgcgtacaatacac |
46354264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 216
Target Start/End: Original strand, 25434052 - 25434144
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccg |
216 |
Q |
| |
|
|||||| |||||||| ||||||| ||| ||||| |||| |||||||| ||||||||| | | | ||||||||| |||||||||||| |||| |
|
|
| T |
25434052 |
cttgtgcaaaaaacatggtaagagtgcatacaacacaccaaaatggtatgacttcttcttggaccctgcgtatgcgggagctttagtgcaccg |
25434144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 132 - 208
Target Start/End: Original strand, 38604567 - 38604642
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagcttta |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||| ||| ||| | | ||||||||| ||||||||| |
|
|
| T |
38604567 |
aaaaacagggtaaggctgcgtacaatacac-caaatggtgagacccctttccggaccctgcgtatgcgggagcttta |
38604642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 124 - 167
Target Start/End: Original strand, 7644989 - 7645032
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaat |
167 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
7644989 |
cttgtgtaaaaaacagggtaagatagcgtacaatacaccaaaat |
7645032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 125 - 223
Target Start/End: Original strand, 18747520 - 18747618
Alignment:
| Q |
125 |
ttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||| ||||||||| ||||||| ||||||| || ||||| ||| ||||| ||| | ||||||||| |||||||||||| |||||| |||| |
|
|
| T |
18747520 |
ttgtgtaaaaaagcagggtaaggctgcgtataatacaccaat-tggtgggaccccttcctgaaccctgcgtatgcgggagctttagtgcaccgggctgcc |
18747618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 133 - 228
Target Start/End: Complemental strand, 31591202 - 31591108
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttt |
228 |
Q |
| |
|
||||||| ||||| |||||||||||||| |||| ||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| |||| |
|
|
| T |
31591202 |
aaaacagagtaaggctgcgtacaatacaataaa-tggtgggaccccttcccggaccttgcatatgcgggagctctagtgcaccgggttgccctttt |
31591108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 134 - 229
Target Start/End: Complemental strand, 39093532 - 39093437
Alignment:
| Q |
134 |
aaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattttt |
229 |
Q |
| |
|
|||||||||||||||| ||||||||||| | ||| ||| || ||||||| | | ||| ||||||| |||||||||| |||||| |||| ||||| |
|
|
| T |
39093532 |
aaacagggtaagactgtgtacaatacaccataatagtgggaacccttcccggaacttgcatatgcagaagctttagtgcaccgggctgcccttttt |
39093437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 230
Target Start/End: Original strand, 1408490 - 1408595
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||||| |||||| ||| |||||||||| |||||||| ||| ||||||| | | ||||||||||| | ||||||| ||||| ||||| |
|
|
| T |
1408490 |
cttgtgtaaaaaacaaggtaaggctgtgtacaataca-gcaaatggtgggaccccttcccggaccctgcgtatgcagaatctttagttcaccggattgcc |
1408588 |
T |
 |
| Q |
224 |
atttttt |
230 |
Q |
| |
|
|||||| |
|
|
| T |
1408589 |
ttttttt |
1408595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 229
Target Start/End: Complemental strand, 13792250 - 13792148
Alignment:
| Q |
127 |
gtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatt |
226 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||| |||||| | ||| |||| |||| | ||||||||| |||||||| ||| |||| | |||| || |
|
|
| T |
13792250 |
gtgtaaaaaacttggtaagactgcatacaatacacccaaatggcgggaccccttctcgaaccctgcgtatgctggagcttttgtgcaccgagctgccctt |
13792151 |
T |
 |
| Q |
227 |
ttt |
229 |
Q |
| |
|
||| |
|
|
| T |
13792150 |
ttt |
13792148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 161
Target Start/End: Original strand, 19266482 - 19266520
Alignment:
| Q |
123 |
acttgtgtaaaaaacagggtaagactgcgtacaatacac |
161 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
19266482 |
acttgcgtaaaaaacagggtaaggctgcgtacaatacac |
19266520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 233
Target Start/End: Complemental strand, 27889395 - 27889310
Alignment:
| Q |
147 |
ctgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattttttact |
233 |
Q |
| |
|
||||||||||||||| ||| ||||| ||| ||||||| | | ||||||||| |||||||| || ||||||||||| ||||||||| |
|
|
| T |
27889395 |
ctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgcccttttttact |
27889310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 230
Target Start/End: Complemental strand, 34626302 - 34626205
Alignment:
| Q |
132 |
aaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
|||||||||||||| |||||| |||||||| |||||||| || ||||||| | | ||||||||| ||||||||||| | ||||||||| |||||| |
|
|
| T |
34626302 |
aaaaacagggtaaggctgcgttcaatacac-caaatggtgggatcccttcccggaccctgcgtatgcgggagctttagttcatcgggttgccctttttt |
34626205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 158
Target Start/End: Original strand, 35203472 - 35203506
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaata |
158 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35203472 |
cttgtgtaaaaaacaggataagactgcgtacaata |
35203506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 223
Target Start/End: Complemental strand, 48735215 - 48735126
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||| |||||| ||||||||||||||| |||||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| |
|
|
| T |
48735215 |
aaaacacggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
48735126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 124 - 229
Target Start/End: Original strand, 27629667 - 27629771
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||| |||||||| ||| ||||||| | ||| ||||| | ||||| |||| ||||||||||| |
|
|
| T |
27629667 |
cttgtgtaaaaaacagggtaaggttgcgtaaaatacac-caaatggtgggaccccttcccgggccctgcatatgcggtagcttcagtgcaccgggttgcc |
27629765 |
T |
 |
| Q |
224 |
attttt |
229 |
Q |
| |
|
||||| |
|
|
| T |
27629766 |
cttttt |
27629771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 230
Target Start/End: Original strand, 36602545 - 36602585
Alignment:
| Q |
190 |
tgcgtatgcaggagctttagtgaaccgggttgccatttttt |
230 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
36602545 |
tgcgtatgcgggagctttagtgcaccgggttgccctttttt |
36602585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 124 - 230
Target Start/End: Complemental strand, 24874 - 24769
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||| |||||||| ||| ||||||||| | ||||||||| |||||||||||| | | ||||||| |
|
|
| T |
24874 |
cttgtgtaaaaaacagggtaaggctgcgtacaacacac-caaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcagccggttgcc |
24776 |
T |
 |
| Q |
224 |
atttttt |
230 |
Q |
| |
|
|||||| |
|
|
| T |
24775 |
ctttttt |
24769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 124 - 230
Target Start/End: Original strand, 46864 - 46969
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| ||| ||||| ||| ||||||| | | ||||||||| |||||||||||| ||||||||||| |
|
|
| T |
46864 |
cttgtgtaaaaaatagggtaaggttgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
46962 |
T |
 |
| Q |
224 |
atttttt |
230 |
Q |
| |
|
|||||| |
|
|
| T |
46963 |
ctttttt |
46969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 124 - 223
Target Start/End: Original strand, 59010 - 59110
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaaatggtgagacttcttccc-gaatcgtgcgtatgcaggagctttagtgaaccgggttg |
221 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| | ||||||||| ||| |||||| || || ||||||||| |||||||||||| | ||||||| |
|
|
| T |
59010 |
cttgtataaaaaacagggtaagactgcgtacaatacaccaaaaatggtgggaccccttcccagactc-tgcgtatgcgggagctttagtgcatcgggttg |
59108 |
T |
 |
| Q |
222 |
cc |
223 |
Q |
| |
|
|| |
|
|
| T |
59109 |
cc |
59110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 124 - 222
Target Start/End: Original strand, 10843 - 10940
Alignment:
| Q |
124 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgc |
222 |
Q |
| |
|
|||||||||||||||||||| | |||||| |||||||| |||||||| ||| ||||||| | | ||||||||| |||||||||||| || ||||||| |
|
|
| T |
10843 |
cttgtgtaaaaaacagggtagggctgcgtccaatacac-caaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcactgggttgc |
10940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 133 - 228
Target Start/End: Complemental strand, 48727 - 48633
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccatttt |
228 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| |||| |
|
|
| T |
48727 |
aaaacagggtaaggctgcgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
48633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 229
Target Start/End: Original strand, 30619 - 30714
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgccattttt |
229 |
Q |
| |
|
||||||||||| | ||||||||||||||| ||| ||||| ||| ||||||| | | ||| ||||| |||||| ||||| ||||||||||| ||||| |
|
|
| T |
30619 |
aaaacagggtagggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
30714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 223
Target Start/End: Complemental strand, 10143 - 10054
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||| ||| ||| ||||||| | | ||| |||||||||||| |||| ||||||||||| |
|
|
| T |
10143 |
aaaacagagtaagactgcgtacaatacac-caaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgcc |
10054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 223
Target Start/End: Complemental strand, 20471 - 20382
Alignment:
| Q |
133 |
aaaacagggtaagactgcgtacaatacactaaaatggtgagacttcttcccgaatcgtgcgtatgcaggagctttagtgaaccgggttgcc |
223 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||| ||| ||| ||||||| | | ||| |||||||||||| |||| ||||||||||| |
|
|
| T |
20471 |
aaaacagagtaagactgcgtacaatacac-caaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgcc |
20382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University