View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20877_high_20 (Length: 221)
Name: NF20877_high_20
Description: NF20877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20877_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 54 - 157
Target Start/End: Complemental strand, 31079383 - 31079282
Alignment:
| Q |
54 |
catttgacccgtcgcagattagggctagagtattgattttgaatttctatattgtgcttactcatcaaaacacattcccgatggagaatagtacaacata |
153 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31079383 |
catttgacccgacgcagattagggctagagtattgattttgaatttctat--tgtgcttactcatcaaaacacattcccgatggagaatagtacaccata |
31079286 |
T |
 |
| Q |
154 |
tata |
157 |
Q |
| |
|
|||| |
|
|
| T |
31079285 |
tata |
31079282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University