View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20877_high_20 (Length: 221)

Name: NF20877_high_20
Description: NF20877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20877_high_20
NF20877_high_20
[»] chr1 (1 HSPs)
chr1 (54-157)||(31079282-31079383)


Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 54 - 157
Target Start/End: Complemental strand, 31079383 - 31079282
Alignment:
54 catttgacccgtcgcagattagggctagagtattgattttgaatttctatattgtgcttactcatcaaaacacattcccgatggagaatagtacaacata 153  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||| ||||    
31079383 catttgacccgacgcagattagggctagagtattgattttgaatttctat--tgtgcttactcatcaaaacacattcccgatggagaatagtacaccata 31079286  T
154 tata 157  Q
    ||||    
31079285 tata 31079282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University