View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20877_high_21 (Length: 212)
Name: NF20877_high_21
Description: NF20877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20877_high_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 14 - 192
Target Start/End: Complemental strand, 21122472 - 21122294
Alignment:
| Q |
14 |
cataggccacttttgttgattcaaaatagatgaagtcttcggatgactgatactgaatacctggtagtggagcaagatgagaaaatggttcaatatcttt |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21122472 |
cataagccacttttgttgattcaaaatagatgaagtcttcggatgactgatacagaatacctggtagtggagcaagatgagaaaatggttcgatatcttt |
21122373 |
T |
|
| Q |
114 |
gcttttgcctttgaacctccccattgcgtctatcttctgcaccatttgtttgcacaaaagatatcgtccacacgttgga |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21122372 |
gcttttgcctttgaacctccccattgcgtctatcttctgcaccatttgtttgcacaaaagatatcgtccacacgttgga |
21122294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 19 - 192
Target Start/End: Complemental strand, 21115040 - 21114867
Alignment:
| Q |
19 |
gccacttttgttgattcaaaatagatgaagtcttcggatgactgatactgaatacctggtagtggagcaagatgagaaaatggttcaatatctttgcttt |
118 |
Q |
| |
|
||||| ||||||||||||||||| ||||| ||||| ||||| ||||| ||||||||||||||||| ||||||||||||||| |||||| |||||| |
|
|
| T |
21115040 |
gccacctttgttgattcaaaataaatgaattcttcaaatgaccgatacctgctacctggtagtggagcacgatgagaaaatggttgaatatcaatgcttt |
21114941 |
T |
|
| Q |
119 |
tgcctttgaacctccccattgcgtctatcttctgcaccatttgtttgcacaaaagatatcgtccacacgttgga |
192 |
Q |
| |
|
| |||||| | ||||||| || |||||||| || |||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
21114940 |
tacctttgtatttccccatcgcatctatcttttgtaccatttgcttgcacaaaagataccgtccacacgttgga |
21114867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University