View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20877_high_4 (Length: 447)

Name: NF20877_high_4
Description: NF20877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20877_high_4
NF20877_high_4
[»] chr2 (3 HSPs)
chr2 (19-117)||(12868487-12868585)
chr2 (232-329)||(12868275-12868372)
chr2 (400-436)||(12868168-12868204)


Alignment Details
Target: chr2 (Bit Score: 99; Significance: 1e-48; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 12868585 - 12868487
Alignment:
19 gaatgaccaagtgattaatcatcgaggttttggatcttcagggtttgttaatgaggctttgttaagagataatgggttgcttcaagatattattcagat 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12868585 gaatgaccaagtgattaatcatcgaggttttggatcttcagggtttgttaatgaggctttgttaagagataatgggttgcttcaagatattattcagat 12868487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 232 - 329
Target Start/End: Complemental strand, 12868372 - 12868275
Alignment:
232 cttttgcagctataggtttgagtttatatgaagttaaccttttggtggttaattgatttggttttaaaatgacattgtagcttataaaaggccctggg 329  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12868372 cttttgcagctataggtttgagtttatatgaagttaaccttttggtggttaattgatttggttttaaaatgacattgtagcttataaaaggccctggg 12868275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 400 - 436
Target Start/End: Complemental strand, 12868204 - 12868168
Alignment:
400 gtaattgtaactatagagattttattccatgatgatg 436  Q
    |||||||||||||||||||||||||| ||||||||||    
12868204 gtaattgtaactatagagattttatttcatgatgatg 12868168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University