View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20877_high_4 (Length: 447)
Name: NF20877_high_4
Description: NF20877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20877_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 1e-48; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 12868585 - 12868487
Alignment:
| Q |
19 |
gaatgaccaagtgattaatcatcgaggttttggatcttcagggtttgttaatgaggctttgttaagagataatgggttgcttcaagatattattcagat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12868585 |
gaatgaccaagtgattaatcatcgaggttttggatcttcagggtttgttaatgaggctttgttaagagataatgggttgcttcaagatattattcagat |
12868487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 232 - 329
Target Start/End: Complemental strand, 12868372 - 12868275
Alignment:
| Q |
232 |
cttttgcagctataggtttgagtttatatgaagttaaccttttggtggttaattgatttggttttaaaatgacattgtagcttataaaaggccctggg |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12868372 |
cttttgcagctataggtttgagtttatatgaagttaaccttttggtggttaattgatttggttttaaaatgacattgtagcttataaaaggccctggg |
12868275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 400 - 436
Target Start/End: Complemental strand, 12868204 - 12868168
Alignment:
| Q |
400 |
gtaattgtaactatagagattttattccatgatgatg |
436 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12868204 |
gtaattgtaactatagagattttatttcatgatgatg |
12868168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University