View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20877_low_15 (Length: 257)
Name: NF20877_low_15
Description: NF20877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20877_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 50 - 239
Target Start/End: Original strand, 38462739 - 38462927
Alignment:
| Q |
50 |
gagtaatattattttacttttgaagttatgctatttcttaaaccgtggtgtctcttagcagaccagaaataaagttggcgttggttttccaaaatcatgt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38462739 |
gagtaatattattttacttttgaagttatgctatttcttaaaccatggcgtctcttagcagaccagaaataaagttggcgttggttttccaaaatcatgt |
38462838 |
T |
 |
| Q |
150 |
ctcaagttttgcagtttgttatgaattgaaaatataaattggtatgtaaacaaatgtaagtgatcttgcagtaatattaatcacattgtt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
38462839 |
ctcaagttttgcagtttgttatgaattgaaaatataaattggtatgtaaacaaatgtaagtaatcttgcagtaa-attaatcacattgtt |
38462927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University