View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20877_low_3 (Length: 457)
Name: NF20877_low_3
Description: NF20877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20877_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 412; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 412; E-Value: 0
Query Start/End: Original strand, 13 - 440
Target Start/End: Original strand, 17478877 - 17479304
Alignment:
| Q |
13 |
tgagatattttgtttatgttttaactcagccatttgattttcatccctatgtgacaacataaaacaagtagaaatcagaaattgtatacaaaattatcga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17478877 |
tgagatattttgtttatgttttaactcagccatttgattttcatccctatgtgacaacataaaacaagtagaaatcagaaattgtatacaaaattatcga |
17478976 |
T |
|
| Q |
113 |
cttttgcttgtcaattttttcataaaattttggtataaggaagttatgatttcaaccttatgtcgtgagttgaagcctcattgttgtgatggaacacttg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17478977 |
cttttgcttgtcaattttttcataaaattttggtataaggaagttatggtttcaaccttatgtcgtgagttgaagcctcattgttgtgatggaacacttg |
17479076 |
T |
|
| Q |
213 |
agcaatggcttcaaactcctcctttgctcgttcaaacacatttggagctttaacatcatccaacgaggtattctcgtctatgtcactattcataccatga |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
17479077 |
agcaatggcttcaaactcctcctttgctcgttcaaacacatttggagctttaacatcatccaacgaggtattctcatctatgtcactattcctaccatga |
17479176 |
T |
|
| Q |
313 |
gtttccttgtgatgatgacttgaagacttatgaggatgcaatatagcctcaaattcttcctttgctctttcaaccaaatcgggtcctcttgcttctttaa |
412 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17479177 |
gtttccctgtgatgatgacttgaagacttatgaggatgcaatatagcctcaaattcttcctttgctctttcaaccaaatcgggtcctcttgcttctttaa |
17479276 |
T |
|
| Q |
413 |
ctaattgcataaaacatcatgacaaaat |
440 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
17479277 |
ctaattgcataaaacatcatgacaaaat |
17479304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University