View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20877_low_7 (Length: 369)
Name: NF20877_low_7
Description: NF20877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20877_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 12 - 350
Target Start/End: Complemental strand, 37161422 - 37161084
Alignment:
| Q |
12 |
aggagcacagaagaggaagacgtcacattaagacattgagaatacggccacctatcttatatatccagcatcatatccattcatatgcgacttgggagca |
111 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37161422 |
aggaccacaaaagaggaagacgtcacattaagacattgagaatacggtcacctatcttatatatccagcatcatatccatttatatgcgacttgggagca |
37161323 |
T |
|
| Q |
112 |
gacggactagcacagtagaggtgcagacagacttagggtagcatagtcaaggcttttggtccctaataaaaccaaacagttttgagcacaaggtgttcac |
211 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37161322 |
gacggactagcacagtagaggcgcagacggacttagggtggcatagtcaaggcttttggtccctaataaaaccaaacagttttgagcacaaggtgttcac |
37161223 |
T |
|
| Q |
212 |
ttccctcttctttcctttttcccttattgattgtgaatagaaaatgtttctgttacgtctactagttgcattctttgtgttgaggagccaagattgattt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37161222 |
ttccctcttctttcctttttcccttattgattgtgaatagaaaatgtttctgttacgtctactagttgcattctttgtgttgaggagccaagattgattt |
37161123 |
T |
|
| Q |
312 |
agaggtggaaaacggatacttacctatttgggtgatatc |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37161122 |
agaggtggaaaacggatacttacctatttgggtgatatc |
37161084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University