View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20878_low_6 (Length: 252)

Name: NF20878_low_6
Description: NF20878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20878_low_6
NF20878_low_6
[»] chr7 (1 HSPs)
chr7 (43-252)||(17297246-17297454)


Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 43 - 252
Target Start/End: Original strand, 17297246 - 17297454
Alignment:
43 agcaaaacaggatctacagatatgacaaatgggaaggnnnnnnnntgaaatgtatctatcaaattctcttgcttaatcaatgttgtgtcacatcaaccaa 142  Q
    |||||||||||||||||||||||||||||||||||||        ||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
17297246 agcaaaacaggatctacagatatgacaaatgggaaggaaaaaaa-tgaaatgtatctatcgaattctcttgcttaatcaatgttgtgtcacatcaaccaa 17297344  T
143 acttcatcacaagatttcagaagcttggtaatcagcttcagaattaaagaaatgaaataccggatgatgtgatataacaattgattaaactgaataaaat 242  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||    
17297345 acttcatcacaagatttcagaagcttggtaatcagcttcagaattaaagaaatgaaataccggatgatgtgacaaaacaattgattaaactgaataaaat 17297444  T
243 gcaagcaaga 252  Q
    ||||||||||    
17297445 gcaagcaaga 17297454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University