View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20878_low_6 (Length: 252)
Name: NF20878_low_6
Description: NF20878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20878_low_6 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 43 - 252
Target Start/End: Original strand, 17297246 - 17297454
Alignment:
| Q |
43 |
agcaaaacaggatctacagatatgacaaatgggaaggnnnnnnnntgaaatgtatctatcaaattctcttgcttaatcaatgttgtgtcacatcaaccaa |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17297246 |
agcaaaacaggatctacagatatgacaaatgggaaggaaaaaaa-tgaaatgtatctatcgaattctcttgcttaatcaatgttgtgtcacatcaaccaa |
17297344 |
T |
|
| Q |
143 |
acttcatcacaagatttcagaagcttggtaatcagcttcagaattaaagaaatgaaataccggatgatgtgatataacaattgattaaactgaataaaat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
17297345 |
acttcatcacaagatttcagaagcttggtaatcagcttcagaattaaagaaatgaaataccggatgatgtgacaaaacaattgattaaactgaataaaat |
17297444 |
T |
|
| Q |
243 |
gcaagcaaga |
252 |
Q |
| |
|
|||||||||| |
|
|
| T |
17297445 |
gcaagcaaga |
17297454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University