View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20879_low_8 (Length: 232)
Name: NF20879_low_8
Description: NF20879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20879_low_8 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 10121681 - 10121450
Alignment:
| Q |
1 |
catcatagcaacctgaatcccaacaagttttgtaaacagaaatcctagccattggtgcacctcccctagcatttcctgctgctaacccattataattcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10121681 |
catcatagcaacctgaatcccaacaagttttgtaaacagaaatcctagccattggtgcacctcccctagcatttcctgctgctaacccattataattcat |
10121582 |
T |
 |
| Q |
101 |
gtttgagacgtatcgtcctgctgctgtggaagctgtatggctcccatgaccagagctgtctcttgcagatctgaaagagacttttttgtctgacccttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10121581 |
gtttgagacgtatcgtcctgctgctgtggaagctgtatggctcccatgaccagagctgtctcttgcagatctgaaagagacttttttgtctgacccttct |
10121482 |
T |
 |
| Q |
201 |
tctgcttcatatccactcatatagtatcttgc |
232 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |
|
|
| T |
10121481 |
tctgtttcatatccactcatatagtatcttgc |
10121450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 30628396 - 30628627
Alignment:
| Q |
1 |
catcatagcaacctgaatcccaacaagttttgtaaacagaaatcctagccattggtgcacctcccctagcatttcctgctgctaacccattataattcat |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||| ||| |||||||| |||||||||||||| ||| ||| ||||| || ||||||||||| |
|
|
| T |
30628396 |
catcatagcaacctgaatcccaacatgttttgtacacagcaattctagccataggtgcacctccccttgcacctccacttgctagtcctttataattcat |
30628495 |
T |
 |
| Q |
101 |
gtttgagacgtatcgtcctgctgctgtggaagctgtatggctcccatgaccagagctgtctcttgcagatctgaaagagacttttttgtctgacccttct |
200 |
Q |
| |
|
|||| || |||| ||||| ||| | |||||||||||||| |||||||| | |||||| || || |||||||| |||| |||| | |||| |||| |
|
|
| T |
30628496 |
gttttgtacatatctccctgcagctattgaagctgtatggctaccatgacctgtgctgtccctagctgatctgaatgagatttttgcatttgactcttcc |
30628595 |
T |
 |
| Q |
201 |
tctgcttcatatccactcatatagtatcttgc |
232 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |
|
|
| T |
30628596 |
tctgcttcatatccactcttatagtatcttgc |
30628627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University