View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2087_high_16 (Length: 260)
Name: NF2087_high_16
Description: NF2087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2087_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 12692894 - 12692646
Alignment:
| Q |
1 |
gaaagaggaagataccatcggttagattgaaagagtgatactcaatcccgacaagcatatcatagttggaatctttgttggtaaacagagtggaaataat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
12692894 |
gaaagaggaagataccatcggttagattgaaagagtgatactcaatcccgacaagcatatcatagttggaatctttgttggtaaacatagtagaaataat |
12692795 |
T |
 |
| Q |
101 |
---gcaattgttttcagactttcatacgattgaaatgtgtttatgcgagcttcaaatagcatttaaagtatcacataatatattttattagagttcaaat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12692794 |
catgcaattgttttcagactttcatacgattgaaatgtgtttatgcgagcttcaaatagcatttaaagtatcacaaaatatattttattagagttcaaat |
12692695 |
T |
 |
| Q |
198 |
taatttttaattagatgatatataaagttttcctccacacaacctggtg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12692694 |
taatttttaattagatgatatataaagttttcctccacacaacctggtg |
12692646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University