View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2087_high_19 (Length: 252)
Name: NF2087_high_19
Description: NF2087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2087_high_19 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 205 - 252
Target Start/End: Original strand, 50768497 - 50768544
Alignment:
| Q |
205 |
atgacttagtagcttgataaagaaagacaagaggagatttatttattt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50768497 |
atgacttagtagcttgataaagaaagacaagaggagatttatttattt |
50768544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 205 - 252
Target Start/End: Complemental strand, 26824660 - 26824613
Alignment:
| Q |
205 |
atgacttagtagcttgataaagaaagacaagaggagatttatttattt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26824660 |
atgacttagtagcttgataaagaaagacaagaggagatttatttattt |
26824613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University