View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2087_high_8 (Length: 448)
Name: NF2087_high_8
Description: NF2087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2087_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 422; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 422; E-Value: 0
Query Start/End: Original strand, 1 - 426
Target Start/End: Original strand, 41705502 - 41705927
Alignment:
| Q |
1 |
gacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgtgaattaaaacccaagcttacctcggatccctctccccctacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705502 |
gacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgtgaattaaaacccaagcttacctcggatccctctccccctacca |
41705601 |
T |
 |
| Q |
101 |
acatctcccacagcacccccatttcatgcaactcccatgcatgctctgtagcacacagttccaccccctcttccgatctatgcacaatggctcattgccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705602 |
acatctcccacagcacccccatttcatgcaactcccatgcatgctctgtagcacacagttccaccccctcttccgatctatgcacaatggctcattgccc |
41705701 |
T |
 |
| Q |
201 |
tttagactccattgaaaccaaagactgcggttcatttcactgtccaccattctactacgcttacggcgatggaagcttaatagcttctctctatcgcgat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705702 |
tttagactccattgaaaccaaagactgcggttcatttcactgtccaccattctactacgcttacggcgatggaagcttaatagcttctctctatcgcgat |
41705801 |
T |
 |
| Q |
301 |
acactttctctttctactcttcaacttacaaaattcacattcggttgtgctcatacaactttctccgaacccaccggagtcgctggcttcggtcgtggat |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705802 |
acactttctctttctactcttcaacttacaaacttcacattcggttgtgctcatacaactttctccgaacccaccggagtcgctggcttcggtcgtggat |
41705901 |
T |
 |
| Q |
401 |
tactttctctcccagctcagttagct |
426 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41705902 |
tactttctctcccagctcagttagct |
41705927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University