View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2087_low_17 (Length: 292)
Name: NF2087_low_17
Description: NF2087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2087_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 16 - 274
Target Start/End: Complemental strand, 44659111 - 44658853
Alignment:
| Q |
16 |
atgatcatcaaaaggcggaccaacgatgggagatggtggatcaggacttagaggcggcaactgcggtatgtagagttgtgactggtgaggaacctgatga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44659111 |
atgatcatcaaaaggcggaccaacgatgggagatggtggatcaggacttagaggcggcaactgcggtatgtagagttgtgactggtgaggaacctgatga |
44659012 |
T |
 |
| Q |
116 |
ctctgggattgagagggtggttcaccagtagaagaatcaatgatagttgtttgttcttgattttgcatcttgaggatatccctttcttcttttaactttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44659011 |
ctctgggattgagagggtggttcaccagaagaagaatcaatgatagttgtttgttcttgattttgcatcttgaggatatccctttcttcttttaactttt |
44658912 |
T |
 |
| Q |
216 |
ctaagaaagctgtaaaaacacaagggtatatatccttggaattaattcatatataccta |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44658911 |
ctaagaaagctgtaaaaacacaagggtatatatccttggaattaattcatatataccta |
44658853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University