View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2087_low_18 (Length: 283)
Name: NF2087_low_18
Description: NF2087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2087_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 43 - 272
Target Start/End: Original strand, 9051231 - 9051460
Alignment:
| Q |
43 |
cgcataaccaaacacaagcaattttcttagctaattggctttgacaatgtcacagatttggagaaatggcaggacatcatcaattggaaatgaagatgaa |
142 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9051231 |
cgcataaccaaacacgagcaattttcttagctaattggctttgacaaagtcacagatttggagaaatggcaggacatcatcaattggaaatgaagatgaa |
9051330 |
T |
 |
| Q |
143 |
cttgaagagagaccaaaatggctagatagatggatggctacaaaaccgtgggagaatagaggaagggcttcaaccgatcaaagagactctattaagactg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9051331 |
cttgaagagagaccaaaatggctagatagatggatggctacaaaaccgtgggagaataggggaagggcttcaaccgatcaaagagactctattaagactg |
9051430 |
T |
 |
| Q |
243 |
tggaagtcgacacatctcaaccttattcat |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9051431 |
tggaagtcgacacatctcaaccttattcat |
9051460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University