View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2087_low_25 (Length: 249)
Name: NF2087_low_25
Description: NF2087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2087_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 26 - 237
Target Start/End: Original strand, 36705165 - 36705388
Alignment:
| Q |
26 |
aaagtcataacgaagaaaaagatgagaagttaactcattgttaccttcacaaagagcacaacgcacattgcca------------atccctcttctcaaa |
113 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36705165 |
aaagtcacaacgaagaaaaagatgagaagttaactcattgttaccttcacaaagagcacaacgcacattgccatatgctagaatgatccctcttctcaaa |
36705264 |
T |
 |
| Q |
114 |
ggattattgcacaatgcacattgttatattgccaaaaaacaccaacgccttgggaggcgtcgggctgcaccacaaccttttaaacaccaacccctctacc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36705265 |
ggattattgcacaatgcacattgttatattgccaaaaaacaccaacgccttgggaggcgtcgggctgcaccacaaccttttaaacaccaactcctctacc |
36705364 |
T |
 |
| Q |
214 |
caggaaaaatttacatttcccctt |
237 |
Q |
| |
|
||||||||| ||||||| |||||| |
|
|
| T |
36705365 |
caggaaaaaattacattacccctt |
36705388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University