View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20880_high_16 (Length: 232)
Name: NF20880_high_16
Description: NF20880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20880_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 43578215 - 43578432
Alignment:
| Q |
1 |
gtatgcaattgagatagcttcgaaaaagggatgaatctctctttggttggaaatagattatcaattggttgctttggtttttaagaattatgatcttgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43578215 |
gtatgcaattgagatagcttcgaaaaagggatgaatctctctttggttggaaatagattatcaattggttgctttggtttttaagaattatgatcttgct |
43578314 |
T |
 |
| Q |
101 |
cattggtgaggttaagaaacggatgactgaattgtcttgagttaacaagaattatgtgatttattatttttcatatctttgaacaagacacttttatgta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||||| |
|
|
| T |
43578315 |
cattggtgaggttaagaaacggatgactgaattgtcttgagttaacaagaattatgtgatttattatttctcatatcttcggacaagacacttttatgta |
43578414 |
T |
 |
| Q |
201 |
gacaacattgatattctt |
218 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
43578415 |
gacaacattgattttctt |
43578432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 6 - 92
Target Start/End: Original strand, 8859712 - 8859799
Alignment:
| Q |
6 |
caattgagatagcttcgaaaaag-ggatgaatctctctttggttggaaatagattatcaattggttgctttggtttttaagaattatg |
92 |
Q |
| |
|
||||||||||||||| ||||| || ||||||||||||||||| |||| | ||| |||||||||| |||| | ||| |||||||||| |
|
|
| T |
8859712 |
caattgagatagctttaaaaaaatggttgaatctctctttggtttgaaacaaattctcaattggttacttttgctttaaagaattatg |
8859799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University