View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20880_high_19 (Length: 220)
Name: NF20880_high_19
Description: NF20880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20880_high_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 24 - 205
Target Start/End: Complemental strand, 42341000 - 42340819
Alignment:
| Q |
24 |
atcacagaggctgtgttggaactcgtcaagggtgagtgagtatatggatgacgattgccttccgagcgatgaagaaatgacattgttgacgtcattcctg |
123 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42341000 |
atcacagaggctgtgttggaactcgtcgagggtgagtgagtatatggatgaagattgccttccgagcgatgaagaaatgacattgttgacgtcattcctg |
42340901 |
T |
|
| Q |
124 |
gtcgcttcttctccttccctctgcaatgattctacctccccttgttgccaattcatctcaccttctcttaccaccatattct |
205 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42340900 |
atcgcttcttctccttccctttgcaatgattctacctccccttgttgccaattcatctcaccttctcttaccaccatattct |
42340819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University