View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20880_low_13 (Length: 244)
Name: NF20880_low_13
Description: NF20880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20880_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 126 - 230
Target Start/End: Complemental strand, 44387052 - 44386948
Alignment:
| Q |
126 |
gcagtgtaagtgatccaaatcagaatcatcagcagaaaattccaagccaagacaagaatgatcaaaaattacaaactcttgttccacgtattgatcaagg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44387052 |
gcagtgtaagtgatccaaatcagaatcatcagcagaaaattccaagccaagacaagaatgatcaaaaattacaaactcttgttccacgtattgatcaagg |
44386953 |
T |
 |
| Q |
226 |
gaatt |
230 |
Q |
| |
|
||||| |
|
|
| T |
44386952 |
gaatt |
44386948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 44387180 - 44387101
Alignment:
| Q |
1 |
atgttctttctatcatcaacatagtgtttacaatggattgattcatcactcgattccaagctaaaatcaatgctacttag |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44387180 |
atgttctttctatcatcaacatagtgtttacaatggattgattcatcactcgattccaagctaaaatcaatgctacttag |
44387101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University