View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20880_low_9 (Length: 256)
Name: NF20880_low_9
Description: NF20880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20880_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 29 - 95
Target Start/End: Complemental strand, 14193806 - 14193740
Alignment:
| Q |
29 |
acaatttgcaaacagagaaataaaaccacaaagtcaatcaacaacttggaaaattcaaataacctca |
95 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14193806 |
acaatttgcaaacagagaaataaaaccataaggtcaatcaacaacttggaaaattcaaataacctca |
14193740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 132 - 198
Target Start/End: Complemental strand, 14193735 - 14193669
Alignment:
| Q |
132 |
atcttcaccacctgcataagcttttcatccaacagaaagtaaagagaattgaaatatccctgtttaa |
198 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14193735 |
atcttcaacacctgcataagctttccatccaacagaaagtaaacagaattgaaatatccctgtttaa |
14193669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University