View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20881_high_2 (Length: 353)
Name: NF20881_high_2
Description: NF20881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20881_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 7e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 27 - 257
Target Start/End: Original strand, 39369708 - 39369942
Alignment:
| Q |
27 |
ttaatatgccgtgccaatatacgctttggtgattgacacccatcaaaactagtcttacaacaatattgaaggtgtattgtataatcttaagatnnnnnnn |
126 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39369708 |
ttaatatgacgtgccaatatatgctttggtgattgacacccatcaaaactagtcttacaacaatattgaaggtgtattgtataatcttaagatgagagaa |
39369807 |
T |
 |
| Q |
127 |
nnnnnnnnnnnnngtgcctttgtaactttacatttgtgcatt----gtttccttgactttattcctgaattagtaagttttatgtcgtacgtgtactgaa |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39369808 |
gagtgagagagaggtgcctttgtaactttacatttgtgcattaattgtttccttgactttattcctgaattagtaagttttatgtcgtacgtgtattgaa |
39369907 |
T |
 |
| Q |
223 |
gaagcttgtgaggaacctttgtaacttcccttgac |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39369908 |
gaagcttgtgaggaacctttgtaacttcccttgac |
39369942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University