View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20882_high_15 (Length: 269)
Name: NF20882_high_15
Description: NF20882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20882_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 31545503 - 31545408
Alignment:
| Q |
1 |
ataacgagagtaaaatgatagaagtgataggcatgcacgatagtgatagaataatgcgttggatgagtgtgtgaaaactgatggtgtatatatata |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31545503 |
ataacgagagtaaaatgatagaagtgataggcatgcgcgatagtgatagaataatgtgttggatgagtgtgtgaaaactgatggtgtatatatata |
31545408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 117 - 184
Target Start/End: Complemental strand, 31545348 - 31545283
Alignment:
| Q |
117 |
tatagagtctctgtgcacatcaagtctnnnnnnntatttcctgaacatctctctacaccttgaaaggt |
184 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
31545348 |
tatatagtctctgtgcacatcaagtctagaaaaatatttcctgaaca--tctctacaccttgaaaggt |
31545283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University