View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20882_high_30 (Length: 227)
Name: NF20882_high_30
Description: NF20882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20882_high_30 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 6 - 227
Target Start/End: Original strand, 33311724 - 33311945
Alignment:
| Q |
6 |
agaaaaagcaagtggaggctccgctagggtttcaaccttctagcatgagtgtggctttcttcaataggattacacaataacagttcaccgttcaattgca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33311724 |
agaaaaagcaagtggaggctccgctagggtttcaaccttctagcatgagtgtggctttcttcaataggattacacaataacagttcaccgttcaattgca |
33311823 |
T |
 |
| Q |
106 |
tgttaatttgtgtaattgccttttggtcaattgctttcaattaagtttcgtgagttagtttctctcaattaaagcttctgattccaccgatcagtgcaat |
205 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33311824 |
tgttaatttgtgtaattgctttttggtcaattgctttcaattaagtttcgtgagttagtttctctcaattaaagcttctgattccaccgatcagtgcaat |
33311923 |
T |
 |
| Q |
206 |
ttggttggtgggattaatcaat |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33311924 |
ttggttggtgggattaatcaat |
33311945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University