View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20882_high_9 (Length: 361)
Name: NF20882_high_9
Description: NF20882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20882_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 343
Target Start/End: Original strand, 3990314 - 3990656
Alignment:
| Q |
1 |
agacagcttttatcatgcagaatgtttcagagaggtaacaccaccttttgattttcttcactcttggtatgcatgcagctttaaacctttatttgatgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3990314 |
agacagcttttatcatgcagaatgtttcagagaggtaacaccaccttttgattttcttcactcttggtatgcatgcagctttaaacctttatttgatgca |
3990413 |
T |
|
| Q |
101 |
ggagtttgattgttatggatgaacttggtagggctacttcttcatctgatgggtttgcaatagcttggagttgctgcgagcatcttttgtcactaaaagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3990414 |
ggagtttgattgttatggatgaacttggtagggctacttcttcatctgatgggtttgcaatagcttggagttgctgcgagcatcttttgtcactaaaagc |
3990513 |
T |
|
| Q |
201 |
gtaattgttgcttcnnnnnnnnnnnnnnattatgataggcatttttaacaaactttatggcatggaattcttgtaactaataaatcaaaggtctccgtta |
300 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3990514 |
gtaattgttgcttctttttattttttttattatgataggcatttttaacaaactttatggcatggaattcttgtaactaataaatcaaaggtctccgtta |
3990613 |
T |
|
| Q |
301 |
gcttttcaatttcccattatttcagtggaagttaaattgaaaa |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3990614 |
gcttttcaatttcccattatttcagtggaagttaaattgaaaa |
3990656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University