View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20882_low_16 (Length: 269)

Name: NF20882_low_16
Description: NF20882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20882_low_16
NF20882_low_16
[»] chr2 (2 HSPs)
chr2 (1-96)||(31545408-31545503)
chr2 (117-184)||(31545283-31545348)


Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 31545503 - 31545408
Alignment:
1 ataacgagagtaaaatgatagaagtgataggcatgcacgatagtgatagaataatgcgttggatgagtgtgtgaaaactgatggtgtatatatata 96  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
31545503 ataacgagagtaaaatgatagaagtgataggcatgcgcgatagtgatagaataatgtgttggatgagtgtgtgaaaactgatggtgtatatatata 31545408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 117 - 184
Target Start/End: Complemental strand, 31545348 - 31545283
Alignment:
117 tatagagtctctgtgcacatcaagtctnnnnnnntatttcctgaacatctctctacaccttgaaaggt 184  Q
    |||| ||||||||||||||||||||||       |||||||||||||  |||||||||||||||||||    
31545348 tatatagtctctgtgcacatcaagtctagaaaaatatttcctgaaca--tctctacaccttgaaaggt 31545283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University