View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20882_low_20 (Length: 250)
Name: NF20882_low_20
Description: NF20882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20882_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 55208296 - 55208415
Alignment:
| Q |
1 |
cacaaacaaacaaaactctctgattcttgctcatgacccgccgttaaaccctcaaactaattaaactcctt---ttattattattattgtacgttataat |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
55208296 |
cacaaacaaacaaaactctctgattcttgctcatgacccgccgttagaccctcaaactaattaaactccttttattattattattattgtacgttataat |
55208395 |
T |
 |
| Q |
98 |
atatgtgggttgagaaacgc |
117 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
55208396 |
atatgtgggttgagaaacgc |
55208415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 166 - 244
Target Start/End: Original strand, 55208461 - 55208539
Alignment:
| Q |
166 |
gatctgaatgaatatgtcaactgatgctcatttccttcaggtgaaccaaaacatgccaactcttcattctgatgatgtc |
244 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
55208461 |
gatctgaatgaatatgtcaattgatgctcatttccttcaggtgaaccaaaacatgccaactcttcattctgatcatgtc |
55208539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University