View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20882_low_25 (Length: 244)
Name: NF20882_low_25
Description: NF20882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20882_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 9 - 169
Target Start/End: Complemental strand, 30500631 - 30500478
Alignment:
| Q |
9 |
tgttttgttttgtgtattttagtaatccgtaaaattgataaaaaggtgagaaaataaagatagagttataacttatagggtgccatttaattaattgtat |
108 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
30500631 |
tgttttttgttgtgtattttagtaatccgtaaaattgataaaaagttgagaaaataaagatagagttata-------gggtgccatttaattaattttat |
30500539 |
T |
 |
| Q |
109 |
tgtcttcatttaatgtccaataaaaattgtatacttaaaattatctcaagagttgttcacc |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30500538 |
tgtcttcatttaatgtccaataaaaattgtatacttaaaattatctcaagagttgttcacc |
30500478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University