View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20884_high_12 (Length: 364)
Name: NF20884_high_12
Description: NF20884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20884_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 120 - 336
Target Start/End: Complemental strand, 6714153 - 6713925
Alignment:
| Q |
120 |
gtgaaagtggttgtttaatatcttggtataggttcttgctttgcggatcaattatctagggttttctagtttccaatcaaagagatgtggtctctgactt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6714153 |
gtgaaagtggttgtttaatatcttggtataggttcttgctttgcggatcaattatctagggttttctagtttccaatcaaagagatgtggtctctgactt |
6714054 |
T |
 |
| Q |
220 |
acgtaccctttgatgtaaggc------------nnnnnnnnnnatccaagaacaagatttaagggtggannnnnnnaacctcattagtagtgaaacccta |
307 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
6714053 |
acgtaccctttgatgtaaggcttttttttttttttttttttttatccaagaacaagatttaagggtggatttttttaacctcattagtagttaaacccta |
6713954 |
T |
 |
| Q |
308 |
actcttatggaggataatgtgtcttgggt |
336 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6713953 |
actcttatggaggataatgtgtcttgggt |
6713925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 20 - 63
Target Start/End: Complemental strand, 6714205 - 6714162
Alignment:
| Q |
20 |
gcttccttgtggtcgtctctgacttaccctttggtgttctctga |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6714205 |
gcttccttgtggtcgtctctgacttaccctttggtgttctctga |
6714162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University