View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20884_high_24 (Length: 293)
Name: NF20884_high_24
Description: NF20884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20884_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 21 - 270
Target Start/End: Complemental strand, 40273239 - 40272990
Alignment:
| Q |
21 |
aaaagaaaagtgcacttacgattagccaagaaaaaacggcactaacgacttcccatctttaggtttattcaattcaaaaccctcccaaaaccttcacgtt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40273239 |
aaaagaaaagtgcacttacgattagccaagaaaaaacggcactaacgacttcccatctttaggtttattcaattcaaaaccctcccaaaaccttcacgtt |
40273140 |
T |
 |
| Q |
121 |
tcgcgaggctcttcttcctccaaaggtgattttgatgggggattttcttgtttatggtggtatctgctgttccgttgctgctgttctttactttatcggc |
220 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40273139 |
tcgcgaggctcttcttcctccaaaggtaattttgatgggggattttcttgtttatggtggtatctgctgttccgttgctgctgttctttactatatcggc |
40273040 |
T |
 |
| Q |
221 |
aaaagccctaacaggtagttccttagtgcaattccattccatataatgtt |
270 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40273039 |
aaaagccctaacaggtagttcgttagtgcaattccattccatataatgtt |
40272990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University