View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20884_high_35 (Length: 255)
Name: NF20884_high_35
Description: NF20884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20884_high_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 3 - 136
Target Start/End: Original strand, 45361249 - 45361381
Alignment:
| Q |
3 |
agaaggagcacagagcacaacaataaacactgtttaagtttaatttttagttgcggggttcggttcggttcctttctactttatcctttatttataatac |
102 |
Q |
| |
|
||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45361249 |
agaagaagaacagagcacaacaataa-cactgtttaagtttaatttttagttgcggggttcggttcggttcctttctactttatcctttatttataatac |
45361347 |
T |
 |
| Q |
103 |
catgatctcatcgatcatgtctttctttcacatg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45361348 |
catgatctcatcgatcatgtctttctttcacatg |
45361381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 214 - 255
Target Start/End: Original strand, 45361445 - 45361486
Alignment:
| Q |
214 |
gtagagcttaggtggttagttactttgcattatagtttagct |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45361445 |
gtagagcttaggtggttagttactttgcattatagtttagct |
45361486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University