View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20884_high_37 (Length: 251)
Name: NF20884_high_37
Description: NF20884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20884_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 7 - 235
Target Start/End: Complemental strand, 2892325 - 2892097
Alignment:
| Q |
7 |
ttgcaatgggacactagagtgtaaaacaattggtacaccaccaaacacaatcatggaatttgctttgaacatgtataacgaccttgatttttacgatgtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2892325 |
ttgcaatgggacactagagtgtaaaacaattggtacgccaccaaacacaatcatggaatttgctttgaacatgtataacgaccttgatttttacgatgtt |
2892226 |
T |
 |
| Q |
107 |
tcgcttgtacaaggtttcaatattccaattcagttaaaaccgtctttaaattcttgtggtaccgttaattgtaccgcggatattaacggagagtgtccta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2892225 |
tcgcttgtacaaggtttcaatattccaattcagttaaaaccgtctttaaattcttgtggtaccgttaattgtaccgccgatattaacggagagtgtccta |
2892126 |
T |
 |
| Q |
207 |
ctccacttaaggtaccaggtggatgtaac |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2892125 |
ctccacttaaggtaccaggtggatgtaac |
2892097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University