View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20884_low_18 (Length: 349)
Name: NF20884_low_18
Description: NF20884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20884_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 3e-67; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 16 - 145
Target Start/End: Complemental strand, 31912784 - 31912655
Alignment:
| Q |
16 |
acattaacaattttgttgttgttgttggaccaagaaaaagaaatacggaaaatcttcgtctcatggaaaagagagaggggaagaggttactttcaccatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31912784 |
acattaacaattttgttgttgttgttggaccaagaaaaagaaatacggaaaatcttcgtctcatggaaaagagagaggggaagaggttactttcaccatc |
31912685 |
T |
 |
| Q |
116 |
tcagaaaatttcagaacacttgaagtccaa |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31912684 |
tcagaaaatttcagaacacttgaagtccaa |
31912655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 277 - 332
Target Start/End: Complemental strand, 31912599 - 31912545
Alignment:
| Q |
277 |
tagttttttctcttcttcaaattggaattataatatttaacctttatcttaattca |
332 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31912599 |
tagttttttctcttcttcaaattggaat-ataatatttaacctttatcttaattca |
31912545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 194 - 240
Target Start/End: Complemental strand, 31912643 - 31912597
Alignment:
| Q |
194 |
ctaatgattttgatttctgaaaagtagataagaattcaattatatag |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31912643 |
ctaatgattttgatttctgaaaagtagataagaattcaattatatag |
31912597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University