View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20884_low_23 (Length: 326)
Name: NF20884_low_23
Description: NF20884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20884_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 6 - 308
Target Start/End: Complemental strand, 5445566 - 5445264
Alignment:
| Q |
6 |
aggagcagagataacagcattgttcacttcatgacccaaataagtttcagcaacttcctttaacttagacaacaccatggaagatatctcttgaggtgaa |
105 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5445566 |
aggaacagtgataacagcattgttcacttcatgacccaaataagtttcagcaacttcctttaacttagacaacaccatggaagatatctcttgaggtgaa |
5445467 |
T |
 |
| Q |
106 |
aaatgtttctcttggcctttgtaattgacaacaatcatgggtttgtctttgtggttcggaacaactttaaaaggccaaagctttatgtcttgttggactg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5445466 |
aaatgtttctcttggcctttgtaattgacaacaatcatgggtttgtctttgtggttcggaacaactttaaaaggccaaagctttatgtcttgttggactg |
5445367 |
T |
 |
| Q |
206 |
tttggtcagagaatcgacggccaatcagacgtttggcatcaaaaacagtgttgtggggatttttggctaattggtttttggcagcatcgcctattaatct |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5445366 |
tttggtcagagaatcgacggccaatcagacgtttggcatcaaaaacagtgttgtggggatatttggctaattggtttttggcagcatcgcctattaatct |
5445267 |
T |
 |
| Q |
306 |
ttc |
308 |
Q |
| |
|
||| |
|
|
| T |
5445266 |
ttc |
5445264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University